In vitro insights into the role of copper ions released from selective laser melted CoCrW-xCu alloys in the potential attenuation of inflammation and osteoclastogenesis

doi:10.1016/j.jmst.2019.09.016

Abstract

Abstract:

In this study, the CoCrW-xCu alloys (x = 2, 3 and 4 wt%) were fabricated using selective laser melting (abbreviated as Co-2Cu, Co-3Cu and Co-4Cu) with the purpose of reducing the inflammation responses and the activity of osteoclast. The metal ions releasing test showed that when the Cu content was less than 4 wt%, the releasing amount of Co and Cr ions was very small; however, when 4 wt% Cu was added in the CoCrW based alloy, the quantity of Co ions was significantly elevated with respect to the other groups due to the segregation of precipitates in the matrix; the Cu²⁺ ion quantity of the Co-2Cu, Co-3Cu and Co-4Cu alloys were 0.05, 0.09 and 0.27 μg/(L cm²) after 7 d immersion, respectively; the RT-qPCR and ELISA data indicated that the expression levels of the pro-inflammatory cytokines (TNF-α and IL-6) were down-regulated in the Co-3Cu and Co-4Cu groups, whereas the expression level of the anti-inflammatory cytokine (IL-10) was up-regulated in all CoCrW-xCu alloys; meanwhile, the Cu-containing CoCrW alloys significantly down-regulated the expression of the NF-κB signal pathway in a Cu content-dependent manner, and the downstream transcription factors of NF-κB signal pathway including NFATc1, TRAP and Cath-K were also down-regulated via potentially manipulating the NF-κB signal pathway. After comprehensive consideration, it is considered that the Co-3Cu alloy is a potential material for self-alleviating inflammatory responses.

Key words: Osteoclast, Selective laser melting, Macrophage, Cu-bearing biomedical alloy, Biocompatibility

Yanjin Lu, Xiongcheng Xu, Chunguang Yang, Ling Ren, Kai Luo, Ke Yang, Jinxin Lin. In vitro insights into the role of copper ions released from selective laser melted CoCrW-xCu alloys in the potential attenuation of inflammation and osteoclastogenesis[J]. J. Mater. Sci. Technol., 2020, 41: 56-67.

Figures/Tables 13

Table 1 The sequences of specific primers used to detect the target genes.

Gene	Forward primer sequence (5′-3′)	Reverse primer sequence (5′-3′)
GAPDH	CGGCAAGTTCAACGGCACAGTCAAGG	ACGACATACTCAGCACCAGCATCACC
IL-6	ATGGAGGAGGCACAGTCAGATG	AACCTAAGCAAGCGAGCAAGC
IL-10	CACCCACTTCCCAGTCAGC	AATCTGTCAGCAGTATGTTGTCC
TNF-α	TGGCGTGTTCATCCGTTCTCTAC	CTACTTCAGCGTCTCGTGTGTTTC
CCR7	TACCTGGTTATCATCCGCACTC	TGGAAGACGACGAACACTACG
MRC1	GTTGACTGTGTTGTTGTGATTGG	GCCGTGGTTGGAGAGATAGG
CTSK	TTCTCACATTCCTTCCTCAACAG	TCCAGCGTCTATCAGCACAG
TRAP	ACGGCTACCTACGCTTTCAC	TTCCAGAGGCTTCCACATACG
NF-κB	TATGGCTTCCCGCACTATGG	CTCCCTGTCGTCACTCTTGG
NFATc1	CCTTCCATCACCTTCCACCAG	CTCCTTACTCATAACCACTTTCGG

Fig. 1. SEM images of the CoCrW alloys with differing Cu contents: (a) CoCrW, (b) Co-2Cu, (c) Co-3Cu, (d) Co-4Cu; Grain boundary maps obtained from EBSD analysis: (e) CoCrW, (f) Co-2Cu, (g) Co-3Cu, (h) Co-4Cu; Grain diameter distribution obtained from EBSD analysis: (i) CoCrW, (j) Co-2Cu, (k) Co-3Cu, (l) Co-4Cu.

Fig. 2. Length fraction of the random HAGB and the Σ3 grain boundaries of CoCrW based alloys with different Cu contents.

Fig. 3. Metal releasing behavior of the CoCrW based alloys with different Cu contents (*p > 0.05, **p < 0.05).

Fig. 4. High-resolution XPS spectra of (a) Co2p, (b) Cr2p and (c) Cu2p of the CoCrW based alloys with differing Cu contents.

Fig. 5. Cell proliferation of RAW264.7 macrophages cultivated on the studied CoCrW based alloys with different Cu contents (*p > 0.05, **p < 0.05).

Fig. 6. Morphologies of the macrophages on the studied CoCrW based alloys after 24 h incubation imaged by fluorescence microscopy (the white arrows indicated the spindle-shaped cells; each “R” was a round cell; the white asterisks were those cells with a more extended appearance and more pseudopodia).

Fig. 7. Secretion levels of (a) TNF-α, (b) IL-6 and (c) IL-10 of RAW264.7 cells on the studied CoCrW based alloys after 3 d incubation assayed by ELISA (*p > 0.05, **p < 0.05).

Fig. 8. Gene expression of (a) CCR-7, (b) MRC-1, (c) TNF-α and (d) IL-6 and (e) IL-10 of RAW264.7 cells on the studied CoCrW based alloys after 7 d incubation assayed by RT-qPCR (*p >0.05, **p < 0.05).

Fig. 9. Morphologies of osteoclasts characterized as giant multinucleated cells on the studied CoCrW based alloys after 4 d incubation characterized by fluorescence microscopy (the white arrows indicated the osteoclast-like giant multinucleated cells).

Fig. 10. (a, b) NF-κB expression of osteoclasts on the studied CoCrW based alloys analyzed by western blot after 7 d of incubation and (c) NF-κB expression of osteoclast on the studied CoCrW based alloys stained by Alexa Fluor 488-conjugated secondary antibody and the nuclei were stained blue with DAPI after 7 d of culture (*p > 0.05, **p < 0.05).

Fig. 11. Gene expression of (a) NFATc1, (b) TRAP and (c) Cath-K of osteoclasts on studied CoCrW based alloys analyzed by RT-qPCR after 7 d of culture (*p > 0.05, **p < 0.05).

Fig. 12. Schematic diagram of Cu2+ ions released from CoCrW-xCu based artificial joint could decrease local in?ammatory responses by inhibiting activity of macrophages and osteoclasts.

References

[1]	S. Zhu, X. Hu, Y. Tao, Z. Ping, L. Wang, J. Shi, X. Wu, W. Zhang, H. Yang, Z. Nie, Y. Xu, Z. Wang, D. Geng, Sci. Rep. 6(2016) 36251.
[2]	J. Cui, M. Zhu, S. Zhu, G. Wang, Y. Xu, D. Geng, J. Surg. Res. 192(2014) 447-453.
[3]	L. Zhu, H. Kang, C.A. Guo, W.S. Fan, Y.M. Wang, L.F. Deng, Z.Q. Yan, Biochem. Biophys. Res. Commun. 484(2017) 64-70.
[4]	G. Liu, C. Ma, P. Wang, P. Zhang, X. Qu, S. Liu, Z. Zhai, D. Yu, J. Gao, J. Liang, W. Dai, L. Zhou, M. Xia, H. Yang, Biochem. Biophys. Res. Commun. 491(2017) 388-395.
[5]	L. Zhang, M. Feng, Z. Li, M. Zhu, Y. Fan, B. Chu, C. Yuan, L. Chen, H. Lv, Z. Hong, D. Hong, J. Cell. Physiol. 233(2018) 7067-7079.
[6]	Y. Li, J. Li, B. Li, H. Qin, X. Peng, Y. Zhao, Y. Chen, Mol. Immunol. 85(2017) 27-34.
[7]	H. Yang, Y. Xu, M. Zhu, Y. Gu, W. Zhang, H. Shao, Y. Wang, Z. Ping, X. Hu, L. Wang, D. Geng, Biomaterials 80 (2016) 1-10.
[8]	M. Buciumeanu, A. Bagheri, J.C.M. Souza, F.S. Silva, B. Henriques, Tribol. Int. 97(2016) 423-430.
[9]	H. Sahasrabudhe, S. Bose, A. Bandyopadhyay, Acta Biomater. 66(2018) 118-128.
[10]	J. Miao, T. Guo, J. Ren, A. Zhang, B. Su, J. Meng, Vacuum 149 (2018) 324-330.
[11]	S. Du, K. Zhang, M. Wen, Y. Qin, R. Li, H. Jin, X. Bao, P. Ren, W. Zheng, Vacuum 150 (2018) 222-231.
[12]	F.Z. Hassani, M. Ketabchi, S. Bruschi, A. Ghiotti, J. Mater. Sci. 51(2016) 4495-4508.
[13]	Z. Zhai, X. Qu, H. Li, K. Yang, P. Wan, L. Tan, Z. Ouyang, X. Liu, B. Tian, F. Xiao, W. Wang, C. Jiang, T. Tang, Q. Fan, A. Qin, K. Dai, Biomaterials 35 (2014) 6299-6310.
[14]	H. Shao, J. Shen, M. Wang, J. Cui, Y. Wang, S. Zhu, W. Zhang, H. Yang, Y. Xu, D. Geng, Biomaterials 60 (2015) 92-99.
[15]	L.M. Klevay, J. Nutr. 127(1997) 1034S.
[16]	C. Peng, Y. Liu, H. Liu, S. Zhang, C. Bai, Y. Wan, L. Ren, K. Yang, J. Mater. Sci. Technol. 35(2019) 2121-2131.
[17]	D.M. Medeiros, Exp. Biol. Med. 241(2016) 1316-1322.
[18]	L. Milkovic, A. Hoppe, R. Detsch, A.R. Boccaccini, N. Zarkovic, J. Biomed. Mater. Res. A 102 (2014) 3556-3561.
[19]	Y. Li, L. Liu, P. Wan, Z. Zhai, Z. Mao, Z. Ouyang, D. Yu, Q. Sun, L. Tan, L. Ren, Biomaterials 106 (2016) 250-263.
[20]	A. Ewald, C. Kappel, E. Vorndran, C. Moseke, M. Gelinsky, U. Gbureck, J. Biomed. Mater. Res. A 100 (2012) 2392-2400.
[21]	Y. Lu, L. Ren, X. Xu, Y. Yang, S. Wu, J. Luo, M. Yang, L. Liu, D. Zhuang, K. Yang, J. Lin, J. Mech. Behav. Biomed. Mater. 81(2018) 130-141.
[22]	Y. Lu, L. Ren, S. Wu, C. Yang, W. Lin, S. Xiao, Y. Yang, K. Yang, J. Lin, Powder Technol. 325(2018) 289-300.
[23]	S. Guo, Y. Lu, S. Wu, L. Liu, M. He, C. Zhao, Y. Gan, J. Lin, J. Luo, X. Xu, Mater. Sci. Eng. C 72 (2016) 631-640.
[24]	E. Zhang, C. Liu, Mater. Sci. Eng. C 69 (2016) 134-143.
[25]	P. Qin, Y. Liu, T. Sercombe, Y. Li, C. Zhang, C. Cao, H. Sun, L.C. Zhang, ACS Biomater. Sci. Eng. 47(2018) 2633-2642.
[26]	J. Wang, S. Zhang, Z. Sun, H. Wang, L. Ren, K. Yang, J. Mater. Sci. Technol. 35(2019) 2336-2344.
[27]	E. Mir, A. Hosseinnezhad, A. Bahrami, M.R. Bekheirnia, Iran. J. Public Health 36 (2007) 24-29.
[28]	L. Weng, S.K. Boda, M.J. Teusink, F.D. Shuler, X. Li, J. Xie, ACS Appl. Mater. Interface 9 (2017) 24484-24496.
[29]	H. Rico, C. Roca-Botran, E.R. Hernández, C. Seco, E. Paez, M.J. Valencia, L.F. Villa, Menopause J. North Am. Menopause Soc. 7(2000) 413-416.
[30]	J. Zhang, H. Jian, S. Xu, K. Wang, Y.U. Shifeng, Prog. Nat. Sci. Mater. Int. 13(2003) 266-270.
[31]	M. Shi, Z. Chen, S. Farnaghi, T. Friis, X. Mao, Y. Xiao, C. Wu, Acta Biomater. 30(2015) 334-344.
[32]	J. Zheng, X. Mao, J. Ling, Q. He, J. Quan, Biol. Trace Elem. Res. 160(2014) 15-23.
[33]	M.L. Marquardt, S.L. Done, M. Sandrock, W.E. Berdon, K.W. Feldman, Pediatrics 130 (2012) e695.
[34]	Y. Zhao, Y. Koizumi, K. Aoyagi, D. Wei, K. Yamanaka, A. Chiba, Addit. Manuf. 26(2019) 202-214.
[35]	Y. Lu, S. Wu, Y. Gan, J. Li, C. Zhao, D. Zhuo, J. Lin, Mater. Sci. Eng. C 49 (2015) 517-525.
[36]	Y. Guo, E.H. Han, J. Wang, J. Mater. Sci. Technol. 31(2015) 403-412.
[37]	D. Wei, A. Anniyaer, Y. Koizumi, K. Aoyagi, M. Nagasako, H. Kato, A. Chiba, Addit. Manuf. 28(2019) 215-227.
[38]	D. Wei, Y. Koizumi, A. Chiba, K. Ueki, K. Ueda, T. Narushima, Y. Tsutsumi, T. Hanawa, Addit. Manuf. 24(2018) 103-114.
[39]	Y. Lu, S. Wu, Y. Gan, S. Zhang, S. Guo, J. Lin, J. Lin, J. Mech. Behav.Biomed. Mater. 55(2016) 179-190.
[40]	Y. Lu, S. Guo, Y. Yang, Y. Liu, Y. Zhou, S. Wu, C. Zhao, J. Lin, J Alloys Compd. 730(2018) 552-562.
[41]	Y. Liu, Y. Zheng, X.H. Chen, J.A. Yang, H. Pan, D. Chen, L. Wang, J. Zhang, D. Zhu, S. Wu, K.W.K. Yeung, R.C. Zeng, Y. Han, S. Guan,Adv. Funct. Mater. 29(2019), 1805402.
[42]	J. Luo, S. Wu, Y. Lu, S. Guo, Y. Yang, C. Zhao, J. Lin, T. Huang, J. Lin, J. Mater. Sci. Mater. Med. 29(2018) 37-53.
[43]	X. Xu, Y. Lu, X. Yang, Z. Du, L. Zhou, S. Li, C. Chen, K. Luo, J. Lin, ACS Biomater. Sci. Eng. 4(2018) 3364-3373.
[44]	Y. Lu, W. Lin, M. Xie, W. Xu, Y. Liu, J. Lin, C. Yu, K. Tang, W. Liu, K. Yang, J. Lin, Appl. Surf. Sci. 464(2019) 262-272.
[45]	W. He, R. Hu, X. Gao, J. Yang, Mater. Charact. 134(2017) 379-386.
[46]	Y.C. Lu, T.K. Chang, S.T. Yeh, H.W. Fang, C.Y. Lin, L.I. Hsu, C.H. Huang, C.H. Huang, Acta Biomater. 20(2015) 147-154.
[47]	X. Liu, S. Zhu, J. Cui, H. Shao, W. Zhang, H. Yang, Y. Xu, D. Geng, L. Yu, Acta Biomater. 10(2014) 4912-4918.
[48]	C. Jiang, J. Shang, Z. Li, A. Qin, Z. Ouyang, X. Qu, H. Li, B. Tian, W. Wang, C. Wu, J. Wang, M. Dai, J. Cell. Physiol. 231(2016) 142-151.
[49]	X. Hu, Oncotarget 8 (2017) 83949-83961.
[50]	W.H. Organization, Ind. J. Med. Res. 105(1997) 246-247.
[51]	D. Chatterjee, K. Entwistle, J. Inst. Met. 101(1973) 53-59.
[52]	H. Mehrer, Diffusion in Solid Metals and Alloys, Springer, Berlin Heidelberg, Berlin, 1990.
[53]	X.M. Chen, Y.C. Lin, F. Wu, J. Alloys Compd. 724(2017) 198-207.
[54]	A.I. Munoz, J. Schwiesau, B. Jolles, S. Mischler, Acta Biomater. 21(2015) 228-236.
[55]	W.J. Wang, K.C. Yung, H.S. Choy, T.Y. Xiao, Z.X. Cai, Appl. Surf. Sci. 443(2018) 167-175.
[56]	A.W.E. Hodgson, S. Kurz, S. Virtanen, V. Fervel, C.O.A. Olsson, S. Mischler, Electrochim. Acta 49 (2004) 2167-2178.
[57]	B.G. Pound, J. Biomed. Mater. Res. A 102 (2014) 1595-1604.
[58]	A. Ouerd, C. Alemany-Dumont, B. Normand, S. Szunerits, Electrochim. Acta 53 (2008) 4461-4469.
[59]	S. Karimi, A.M. Alfantazi, Mater. Sci. Eng. C 40 (2014) 435-444.
[60]	A.D. Schoenenberger, A. Schipanski, V. Malheiro, M. Kucki, J.G. Snedeker, P. Wick, K. Maniuraweber, ACS Biomater. Sci. Eng. 2(2016) 908-919.
[61]	J. McCarley, R. Helmink, R. Goetz, S. Tin, Metall. Mater. Trans. A 48 (2017) 1666-1677.
[62]	Z. Ping, X. Hu, L. Wang, J. Shi, Y. Tao, X. Wu, Z. Hou, X. Guo, W. Zhang, H. Yang, Y. Xu, Z. Wang, D. Geng, Acta Biomater. 51(2017) 513-525.
[63]	Q. Wang, X. Sun, Biomater. Sci. 5(2017) 1407-1420.
[64]	E. Ingham, J. Fisher, Biomaterials 26 (2005) 1271-1286.
[65]	A.D. Schoenenberger, A. Schipanski, V. Malheiro, M. Kucki, J.G. Snedeker, P. Wick, K. Maniuraweber, ACS Biomater. Sci. Eng. 2(2016) 908-919.
[66]	D.I. Cho, M.R. Kim, H.Y. Jeong, H.C. Jeong, M.H. Jeong, S.H. Yoon, Y.S. Kim, Y. Ahn, Exp. Mol. Med. 46(2014) e70.
[67]	F.O. Martinez, S. Gordon, F1000Prime Rep. 6(2014) 13-26.
[68]	N. Wang, H. Liang, K. Zen, Front. Immunol. 5(2014) 614-623.
[69]	J.Y. Park, T.W. Chung, Y.J. Jeong, C.H. Kwak, S.H. Ha, K.M. Kwon, F. Abekura, S.H. Cho, Y.C. Lee, K.T. Ha, J. Magae, Y.C. Chang, C.H. Kim,PLoS One 12 (2017),e0171322.
[70]	L. Peng, H. Wang, K. Song, H. Wang, P. Liu, Mol. Med. Rep. 13(2016) 1010-1018.
[71]	E. Jimi, K. Aoki, H. Saito, F. D’Acquisto, M.J. May, I. Nakamura, T. Sudo, T. Kojima, F. Okamoto, H. Fukushima, K. Okabe, K. Ohya, S. Ghosh, Nat. Med. 10(2004) 617-624.
[72]	G. Bolat, J. Izquierdo, J.J. Santana, D. Mareci, R.M. Souto, Electrochim. Acta 88 (2013) 447-456.
[73]	Y.P. Zhao, J.L. Wei, Q.Y. Tian, A.T. Liu, Y.S. Yi, T.A. Einhorn, C.J. Liu, Sci. Rep. 6(2016) 20909.
[74]	S.B. Goodman, E. Gibon, J. Pajarinen, T.H. Lin, M. Keeney, P.G. Ren, C. Nich, Z. Yao, K. Egashira, F. Yang, Y.T. Konttinen,J. R. Soc. Interface 11 (2014), 20130962.