Lanthanum doped octacalcium phosphate/polylactic acid scaffold fabricated by 3D printing for bone tissue engineering

doi:10.1016/j.jmst.2021.09.069

Abstract

Abstract:

Lanthanum (La) has tremendous potential in the treatment and prevention of bone diseases especially osteoporosis and metabolic disorders. However, controlling its distribution and keeping the release of La³⁺ ions sustained and steady in the body is still a big challenge. In this study, we prepared La-OCP powders via co-precipitation method, and further prepared La-OCP/PLA porous scaffolds by 3D printing. La³⁺ was successfully introduced into the OCP crystal structure and substituted Ca²⁺ at the Ca-5 and Ca-8 sites. In particular, some La³⁺ ions were deposited on the crystal surface in the form of nanoparticles. Both octacalcium phosphate (OCP, Ca₈H₂(PO₄)₆·5H₂O) crystals and nanoparticles played as the carriers for La³⁺ ions. The La-OCP/PLA scaffolds displayed obvious mineralization effects and sustained release of La³⁺. The scaffolds contained a uniform structure with rough micro surface topography which acted as a suitable pathway for BMSCs cells to adhere, grow and proliferation. At a certain La³⁺ concentration, the extracts from La-OCP/PLA scaffolds increased the expression of osteogenesis-related genes, thus promoting the osteogenic differentiation of BMSCs. Moreover, the extracts regulated the immune responses. The experiment in vivo proved that La-OCP/PLA porous scaffolds were safe and could enhance bone defect regeneration in vivo. These findings suggest that 3D printed La-OCP/PLA porous scaffolds have promising potentials in bone tissue engineering.

Key words: Lanthanum, Octacalcium phosphate, Scaffold, 3D printing, Bone tissue engineering, Polylactic acid

Zeya Xu, Bin Lin, Chaoqian Zhao, Yanjin Lu, Tingting Huang, Yan Chen, Jungang Li, Rongcan Wu, Wenge Liu, Jinxin Lin. Lanthanum doped octacalcium phosphate/polylactic acid scaffold fabricated by 3D printing for bone tissue engineering[J]. J. Mater. Sci. Technol., 2022, 118: 229-242.

Figures/Tables 16

Scheme 1. Schematic illustration of preparation and application of La-OCP/PLA scaffolds.

Table 1. The respective reactants ratios of all groups.

Samples ID	Ca(CH₃COO)₂·H₂O (mmol)	LaCl₃·7H₂O (mmol)	NH₄H₂PO₄ (mmol)	CO(NH₂)₂ (mmol)
Undoped OCP	12.00	0	9	30
0.2La-OCP	11.976	0. 024	9	30
0.5La-OCP	11.94	0. 06	9	30
1La-OCP	11.88	0. 12	9	30

Table 2. Validated primer sequences for real-time PCR.

Gene	Direction	Sequence (5′-3′)
RUNX-2	Forward	CAGATTACAGATCCCAGGCAGAC
RUNX-2	Reverse	AGGTGGCAGTGTCATCATCTGAA
OCN	Forward	AATAGACTCCGGCGCTACCT
OCN	Reverse	ATAGATGCGCTTGTAGGCGT
COL1	Forward	CGAGTATGGAAGCGAAGGTT
COL1	Reverse	CTTGAGGTTGCCAGTCTGTT
CD206	Forward	GCTTCCGTCACCCTGTATGC
CD206	Reverse	TCATCCGTGGTTCCATAGACC
ARG1	Forward	CAGCAGAGGAGGTGAAGAGTA
ARG1	Reverse	TAGTCAGTCCCTGGCTTATGG
TNF-α	Forward	GCCGATGGGTTGTACCTTGT
TNF-α	Reverse	TCTTGACGGCAGAGAGGAGG
CCR7	Forward	TGTACGAGTCGGTGTGCTTC
CCR7	Reverse	GGTAGGTATCCGTCATGGTCTTG
GAPDH	Forward	ACGGCAAGTTCAACGGCACAG
GAPDH	Reverse	GAAGACGCCAGTAGACTCCACGAC

Fig. 1. XRD patterns (A), TG-DTG plots (B), FTIR spectra (C) and Raman spectra (D) of OCP and La-OCP powders.

Fig. 2. XPS high-resolution results for Ca2p (A), O1s (B), P2p (C), La3d (D) and full pattern (E) of OCP and La-OCP powders.

Table 3. Expected and measured elemental molar ratio on the surface of undoped OCP and La-OCP powders by XPS.

Samples	La/(La+Ca) molar ratio
Samples	Measured value	Expected value
Undoped OCP	0	0
0.2La-OCP	0.043	0.002
0.5La-OCP	0.048	0.005
1La-OCP	0.087	0.010

Fig. 3. SEM images (A-D) of undoped OCP and La-OCP powders. Bright-field TEM micrographs (E, F), corresponding SAD patterns with the [1 1 0] zone axis (G, H), HRTEM images (I, J), bright-field images after irradiation (K, L) of OCP and 1La-OCP powders. AFM images (M, N) of OCP and 1La-OCP powders.

Table 4. Chemical components of undoped OCP and La-OCP powders by EDS.

Samples	Elements (at.%)			La/(La + Ca) molar ratio		(La + Ca)/P molar ratio
Samples	Ca	P	La	Measured value	Expected value	Measured value	Expected value
Undoped OCP	20.29±0.85	14.24±0.45	0	0	0	1.4249	1.33
0.2La-OCP	19.97±0.47	14.29±0.27	0.05±0.01	0.0025	0.002	1.4010	1.33
0.5La-OCP	20.78±0.27	14.51±0.05	0.11±0.02	0.0053	0.005	1.4397	1.33
1La-OCP	19.44±0.38	14.03±0.26	0.19±0.01	0.0097	0.01	1.3991	1.33

Fig. 4. Crystal structure of OCP and corresponding substitutions of Ca2+ with La3+.

Fig. 5. SEM images of OCP/PLA and La-OCP/PLA scaffolds.

Fig. 6. Surface morphologies of OCP/PLA and La-OCP/PLA scaffolds after mineralization (A-H). Mechanical strength (I, J) of OCP/PLA and La-OCP/PLA scaffolds. Ions release (K, L) after soaking of scaffolds at different time.

Fig. 7. The live/dead staining fluorescence images (A) and proliferation (B) of BMSCs cultured with extract liquid of OCP/PLA and La-OCP/PLA scaffolds. BMSCs adhesion to OCP/PLA and La-OCP/PLA scaffolds (C).

Fig. 8. ALP staining images (A) and Alizarin red staining images of BMSCs (B) cultured with extracts. Osteogenesis relative genes expression of BMSCs cultured with extracts over 7 and 14 days (C, D).

Fig. 9. The live/dead staining fluorescence images (A) and proliferation (B) of RAW264.7 macrophages cultured with extract liquid of OCP/PLA and La-OCP/PLA scaffolds. The expression of anti-inflammation (C) and pro-inflammatory (D) related genes of RAW264.7 macrophages cultured with extracts over 3 days. Detection of M1 and M2 polarization of RAW264.7 macrophages cultured with extracts over 3 days by flow cytometry with macrophages labeled according to CD86 and CD206 expression (E, F).

Fig. 10. H&E staining of heart, liver, spleen, lung and kidney of rats after 8 weeks of implantation.

Fig. 11. H&E and staining and Masson's trichrome staining of the skull specimens implanted with OCP/PLA and La-OCP/PLA scaffolds after 8 weeks of implantation.

References 73

[1]	V. Mourino, A.R. Boccaccini, J. R. Soc. Interface 7 (2010) 209-227. DOI URL
[2]	H. Seitz, W. Rieder, S. Irsen, B. Leukers, C. Tille, J. Biomed. Mater. Res. B Appl. Biomater. 74 (2010) 782-788.
[3]	J.C. Reichert, S. Saifzadeh, M.E. Wullschleger, D.R. Epari, M. Schütz, G.N. Duda, H. Schell, M.V. Griensven, H. Redl, D.W. Hutmacher, Biomaterials 30 (2009) 2149-2163. DOI URL
[4]	C. Delloye, O. Cornu, V. Druez, O. Barbier, J. Bone Jt. Surg. Br. 89 (2007) 574-579.
[5]	C. Deng, R. Lin, M. Zhang, C. Qin, Q. Yao, L. Wang, J. Chang, C. Wu, Adv. Funct. Mater. 29 (2019) 1806068. DOI URL
[6]	G. Yang, H. Liu, Y. Cui, J. Li, S. Zhang, Biomaterials 268 (2021) 120561. DOI URL
[7]	H. Saijo, Y. Fujihara, Y. Kanno, K. Hoshi, A. Hikita, U.I. Chung, T. Takato, Regen. Ther. 5 (2016) 72-78.
[8]	S.V. Dorozhkin, M. Epple, Angew. Chem. Int. Ed. 41 (2002) 3130-3146. DOI URL
[9]	N.L. Davison, B.T. Harkel, T. Schoenmaker, X. Luo, H. Yuan, V. Everts, F.B.D. Groot, J.D. Bruijn, Biomaterials 35 (2014) 7441-7451. DOI PMID
[10]	I. Denry, L.T. Kuhn, Dent. Mater. 32 (2016) 43-53. DOI URL
[11]	W. Yu, X. Wang, J. Zhao, Q. Tang, M. Wang, X. Ning, Ceram. Int. 41 (2015) 10600-10606. DOI URL
[12]	E. Boanini, M. Gazzano, A. Bigi, Acta Biomater. 6 (2010) 1882-1894. DOI PMID
[13]	A. Bigi, E. Boanini, in: O. Suzuki, G. Insley (Eds.), Functionalization of octa-calcium phosphate for bone replacement, Woodhead Publishing, Octacalcium Phosphate Biomaterials, 2020, pp. 37-54.
[14]	O. Suzuki, Y. Shiwaku, R. Hamai, Dent. Mater. J. 39 (2020) 187-199. DOI PMID
[15]	H. Shi, F. He, J. Ye, J. Mater. Chem. B 4 (2016) 1712-1719. DOI URL
[16]	O. Suzuki, M. Nakamura, Y. Miyasaka, M. Kagayama, M. Sakurai, Tohoku J. Exp. Med. 164 (1991) 37. PMID
[17]	O. Suzuki, in: O. Suzuki, G. Insley (Eds.), Evolution of octacalcium phos-phate biomaterials, Octacalcium Phosphate Biomaterials, Woodhead Publish-ing, 2020, pp. 1-15.
[18]	N. Miyatake, K.N. Kishimoto, T. Anada, H. Imaizumi, E. Itoi, O. Suzuki, Bioma-terials 30 (2009) 1005-1014.
[19]	Y. Murakami, Y. Honda, T. Anada, H. Shimauchi, O. Suzuki, Acta Biomater. 6 (2010) 1542-1548. DOI URL
[20]	Y. Sai, Y. Shiwaku, T. Anada, K. Tsuchiya, T. Takahashi, Acta Biomater. 69 (2018) 362-371. DOI URL
[21]	W.E. Brown, M. Mathew, M.S. Tung, Prog. Cryst. Growth Charact. Mater. 4 (1981) 59-87.
[22]	H. Shi, X. Ye, J. Zhang, T. Wu, J. Ye, Bioact. Mater. 6 (2021) 1267-1282.
[23]	H. Shi, S. Yang, S. Zeng, X. Liu, J. Zhang, J. Zhang, T. Wu, X. Ye, T. Yu, C. Zhou, Appl. Mater. Today 15 (2019) 100-114.
[24]	Y. Sugiura, H. Obika, M. Horie, K. Niitsu, Y. Makita, ACS Omega 5 (2020) 24434-24444. DOI PMID
[25]	E. Boanini, M. Gazzano, K. Rubini, A. Bigi, Cryst. Growth Des. 10 (2010) 3612-3617. DOI URL
[26]	H. Hu, P. Zhao, J. Liu, Q. Ke, D. Hao, J. Nanobiotechnol. 16 (2018) 1987-1997.
[27]	K. Wieszczycka, K. Staszak, M. Woźniak-Budych, S. Jurga, Coord. Chem. Rev. 388 (2019) 248-267. DOI URL
[28]	D.M. Weekes, C. Orvig, Chem. Soc. Rev. 45 (2016) 2024-2031. DOI PMID
[29]	S. Rosenberg, U.A. Wehr, J. Anim. Physiol. Anim. Nutr. 96 (2012) 885-894. DOI URL
[30]	J. Aaseth, A.L. Bjorke-Monsen, Curr. Med. Chem. 25 (2018) 113-117. DOI PMID
[31]	A. Motameni, A.D. Dalgic, A.Z. Alshemary, D. Keskin, Z. Evis, Mater. Today Conmun. 23 (2020) 101151.
[32]	A.J. Hutchison, M.E. Barnett, R. Krause, J.T.C. Kwan, G.A. Siami, Nephron Clin. Pract. 110 (2008) c15-c23. DOI URL
[33]	A.A. Tsyganova, O.A. Golovanova, Inorg. Mater. 53 (2017) 1261-1269. DOI URL
[34]	M. Zhang, R. Lin, X. Wang, J. Xue, C. Wu, Sci. Adv. 6 (2020) eaaz6725. DOI URL
[35]	Y. Yang, X. Li, M. Chu, H. Sun, J. Jin, K. Yu, Q. Wang, Q. Zhou, Y. Chen, Sci. Adv. 5 (2019) eaau9490. DOI URL
[36]	Y. Liu, D. Luo, T. Wang, Small 12 (2016) 4611-4632. DOI URL
[37]	J. Li, X. Cui, G.J. Hooper, K.S. Lim, T. Woodfield, J. Mech. Behav. Biomed. Mater. 105 (2020) 103671. DOI URL
[38]	B.F. Langdahl, S. Dempster, D.W. Ther, Adv. Musculoskelet. Dis. 8 (2016) 225-235.
[39]	S. Bose, S. Vahabzadeh, A. Bandyopadhyay, Mater. Today 16 (2013) 496-504. DOI URL
[40]	A.C. Jones, C.H. Arns, A.P. Sheppard, D.W. Hutmacher, B.K. Milthorpe, M.A. Knackstedt, Biomaterials 28 (2007) 2491-2504. DOI URL
[41]	P. Kazimierczak, A. Benko, K. Palka, C. Canal, D. Kolodynska, A. Przekora, J. Mater. Sci. Technol. 43 (2020) 52-63. DOI
[42]	E. Kaivosoja, G. Barreto, K. Levón, S. Virtanen, Y.T. Konttinen, Ann. Med. 44 (2012) 635-650. DOI PMID
[43]	S.V. Dorozhkin, Calcium, Phosphorus, Renal Bone Disease, and Calciphylaxis, in: Calcium orthophosphate (CaPO4)-based bone-graft substitutes and the special roles of octacalcium phosphate materials, Woodhead Publishing, 2020, pp. 213-287. O. Suzuki, G. Insley (eds.).
[44]	L. Zhang, G. Yang, B.N. Johnson, X. Jia, Acta Biomater. 84 (2018) 16-33. DOI URL
[45]	Q. Yan, H. Dong, J. Su, J. Han, S. Bo, Q. Wei, Y. Shi, Engineering 4 (2018) 729-742. DOI URL
[46]	J.K. Zhang, W.H. Zhou, H. Wang, K.L. Lin, F.S. Chen, J. Mater. Sci. Technol. 35 (2019) 336-343.
[47]	H. Shi, F. He, J. Ye, J. Mater. Chem. B 4 (2016) 1712-1719. DOI URL
[48]	H. Liu, T. Zhang, X.U. Shanjin, K. Wang, Chin. Sci. Bull. 51 (2006) 28-33. DOI URL
[49]	D. Liu, J. Zhang, G. Wang, X. Liu, M. Yang, Biol. Trace Elem. Res. 150 (2012) 433-440. DOI URL
[50]	T. Kokubo, H. Takadama, Biomaterials 27 (2006) 2907-2915. DOI URL
[51]	I. Irmingerfinger, Int. J. Biochem. Cell Biol. 41 (2009) 380-389. DOI URL
[52]	R. Ishiko-Uzuka, T. Anada, K. Ko Ba Yashi, T. Kawai, O. Suzuki, J. Biomed. Mater. Res. B Appl. Biomater. 105 (2017) 1029-1039. DOI URL
[53]	B.O. Fowler, M. Markovic, W.E. Brown, Chem. Mater. 5 (2002) 1417-1423. DOI URL
[54]	R. Xin, Y. Leng, N. Wang, J. Cryst. Growth 289 (2006) 339-344. DOI URL
[55]	C.H. Huang, Rare Earth Coordination Chemistry: Fundamentals and Applica- tions, John Wiley & Sons (Asia) Pte Ltd, 2010.
[56]	R.A. Qazi, K.J. Martin, Calcium, Phosphorus, Renal Bone Disease, and Calciphy-laxis, in: Therapy in Nephrology & Hypertension (Third Edition) , Saunders, 2008, pp. 765-772.
[57]	O. Suzuki, Acta Biomater. 6 (2010) 3379-3387. DOI PMID
[58]	M. Sun, P.J. Kingham, A.J. Reid, S.J. Armstrong, S. Downes, J. Biomed. Mater. Res. A 93 (2009) 1470-1481.
[59]	O. Suzuki, H. Imaizumi, S. Kamakura, T. Katagiri, Curr. Med. Chem. 15 (2008) 305-313. PMID
[60]	X. Yang, L. Zhang, X. Chen, G. Yang, Z. Gou, Acta Biomater. 8 (2011) 1586-1596. DOI URL
[61]	J.F. Cawthray, A.L. Creagh, C.A. Haynes, C. Orvig, lnorg. Chem. 54 (2015) 1440-1445. DOI URL
[62]	A. Serret, M.V. Cabanas, M. Vallet-Regí, Chem. Mater. 12 (2011) K155-K157.
[63]	M. Wakamura, K. Kandori, T. Ishikawa, Colloids Surf. Physicochem. Eng. Asp. 164 2000) 297-305. DOI URL
[64]	G.N. Kousalya, M.R. Gandhi, C.S. Sundaram, S. Meenakshi, Carbohydr. Polym. 82 (2010) 594-599. DOI URL
[65]	K. Kandori, S. Toshima, M. Wakamura, M. Fukusumi, Y. Morisada, J. Phys. Chem. B 114 (2010) 2399. DOI URL
[66]	S. Wu, X. Liu, K. Yeung, C. Liu, X. Yang, Mater. Sci. Eng. R Rep. 80 (2014) 1-36. DOI URL
[67]	M. He, X. Chen, K. Cheng, W. Weng, H. Wang, ACS. Appl. Mater. Interfaces 8 (2016) 6944-6952. DOI URL
[68]	H. Wang, J.Q. Liu, C.T. Wang, S.G. Shen, X.D. Wang, K.L. Lin, J. Mater. Sci. Technol. 63 (2021) 18-26. DOI
[69]	L.N. Zhong, J.Y. Chen, Z.Y. Ma, H. Feng, S. Chen, H. Cai, Y.Y. Xue, X.B. Pei, J. Wang, Q.B. Wan, Nanoscale 12 (2020) 24437-24449. DOI URL
[70]	H. Qiao, Q. Zou, C. Yuan, X. Zhang, S. Han, Z. Wang, X. Bu, H. Tang, Y. Huang, Ceram. Int. 44 (2018) 16632-16646. DOI URL
[71]	D.D. Liu, K. Ge, J. Sun, S.Z. Chen, G. Jia, J.C. Zhang, RSC Adv. 5 (2015) 42233-42241. DOI URL
[72]	Y.J. Lu, X.C. Xu, C.G. Yang, L. Ren, K. Luo, K. Yang, J.X. Lin, J. Mater. Sci. Technol. 41 (2020) 56-67. DOI URL
[73]	Q. Wang, Y. Tang, Q. Ke, W. Yin, C. Zhang, Y. Guo, J. Guan, J. Mater. Chem. B 8 (2020) 5280-5292. DOI URL