Mussel-inspired multifunctional coating for bacterial infection prevention and osteogenic induction

doi:10.1016/j.jmst.2020.08.011

Abstract

Abstract:

Bacterial infection and osteogenic integration are the two main problems that cause severe complications after surgeries. In this study, the antibacterial and osteogenic properties were simultaneously introduced in biomaterials, where copper nanoparticles (CuNPs) were generated by in situ reductions of Cu ions into a mussel-inspired hyperbranched polyglycerol (MI-hPG) coating via a simple dip-coating method. This hyperbranched polyglycerol with 10 % catechol groups’ modification presents excellent antifouling property, which could effectively reduce bacteria adhesion on the surface. In this work, polycaprolactone (PCL) electrospun fiber membrane was selected as the substrate, which is commonly used in biomedical implants in bone regeneration and cardiovascular stents because of its good biocompatibility and easy post-modification. The as-fabricated CuNPs-incorporated PCL membrane [PCL-(MI-hPG)-CuNPs] was confirmed with effective antibacterial performance via in vitro antibacterial tests against Staphylococcus aureus (S. aureus), Escherichia coli (E. coli), and multi-resistant E. coli. In addition, the in vitro results demonstrated that osteogenic property of PCL-(MI-hPG)-CuNPs was realized by upregulating the osteoblast-related gene expressions and protein activity. This study shows that antibacterial and osteogenic properties can be balanced in a surface coating by introducing CuNPs.

Key words: Mussel-inspired coating, CuNPs, Multi-resistant bacteria, Antibacterial, Antifouling, Osteogenesis

Mingjun Li, Christoph Schlaich, Jianguang Zhang, Ievgen S. Donskyi, Karin Schwibbert, Frank Schreiber, Yi Xia, Jörg Radnik, Tanja Schwerdtle, Rainer Haag. Mussel-inspired multifunctional coating for bacterial infection prevention and osteogenic induction[J]. J. Mater. Sci. Technol., 2021, 68: 160-171.

Figures/Tables 14

Scheme 1. The straightforward technique to prepare biomimetic mussel-inspired antifouling surface, which confers implants the abilities of osteogenesis promotion and prevention of bacterial infection, exhibits tremendous potential in orthopaedic and dental applications.

Table 1 Primer sequences used in this test.

Gene	Primer Sequence (5′-3′)
RUNX-2	F: GGTATGTCCGCCACCACTC R: TGACGAAGTGCCATAGTAGAGATA
ALP	F: GTGGAGTATGAGAGTGACGAGAA
ALP	R: AGATGAAGTGGGAGTGCTTGTAT
GAPDH	F: GCAAGAGCACAAGAGGAAGAG
GAPDH	R: AAGGGGTCTACATGGCAACT

Fig. 1. Images of synthesized PCL membranes (a), SEM image of CuNPs incorporated PCL fibres (b), and size bar chart fitted with Gaussian curve of CuNPs (c).

Fig. 2. Characterization of functionalized PCL membranes. SEM images and XPS spectra of PCL (a, b), PCL-(MI-hPG) (c, d), and PCL-(MI-hPG)-CuNPs (e, f), respectively, where the particles in red circles (e) represent the CuNPs confirmed by XPS (f), scale bar 1 μm. Insets: images of 3 μL water droplets on these surfaces and the results of WCA measurements.

Table 2 Elemental composition of the polymer coated surfaces measured by XPS analysis.

Surfaces	Relative molar ratio of surface element (at.%)
Surfaces	C 1s	N 1s	O 1s	Cu 2p
PCL	77.6	0	22.4	-
PCL-(MI-hPG)	71.4	0.8	27.8	-
PCL-(MI-hPG)-CuNPs	71.1	1.1	27.2	0.6

Table 3 Elemental composition of the PCL-(MI-hPG)-CuNPs coated surfaces after immersed in Milli-Q water for 1-4 weeks measured by XPS analysis.

Surfaces	Relative molar ratio of surface element (at.%)
Surfaces	C 1s	N 1s	O 1s	Cu 2p
1 week	72.8	0.4	26.6	0.2
2 weeks	72.0	1.0	26.9	0.1
4 weeks	71.8	0.8	27.3	0.1

Fig. 3. XPS data of functionalized PCL membranes after immersed in Milli-Q water for 1 week (a), 2 weeks (b), and 4 weeks (c). Fresh Milli-Q water was exchanged each day.

Fig. 4. CFU counts of survival E. coli (DH5α) (a) and S. aureus (SH1000) (b) with the initial bacterial concentration of 105 CFU/mL. The detection limit is shown by the horizontal line. Data are presented as the mean ± SD, n = 4. Statistically significant differences at the same period are indicated **p < 0.01 compared with PCL sample.

Fig. 5. CFU counts of survival multi-resistant E. coli J53 (pMG101) ΔblaZ with the initial bacterial concentration of 104 CFU/mL (The detection limit is shown by the horizontal line) (a); antibacterial assessment of CuCl2 solutions against E. coli (DH5α, 105 CFU/mL) (b); peroxidase activity tests by using different volumes of PCL-(MI-hPG)-CuNPs leachate after 24 h immersion in Milli-Q water and the corresponding controls in the absence of CuNPs or horseradish peroxidase (HRP) (c); Cu releasing profile in Milli-Q water (d). Data are presented as the mean ± SD, n = 4. Statistically significant differences at the same period are indicated **p < 0.01 compared with PCL sample or blank control.

Fig. 6. CFU counts of survival E. coli (DH5α) with the initial bacterial concentration of 105 CFU/mL. The detect limit is shown by the horizontal line. Antibacterial rate was labeled in the figure. Data are presented as the mean ± SD, n = 4. Statistically significant differences in the same period are indicated **p < 0.01 compared with PCL sample.

Fig. 7. Antifouling properties of PCL-(MI-hPG)-CuNPs against E. coli (DH5α). Representative images of adhered cells stained with DAPI on PCL (a), PCL-(MI-hPG) (b), and PCL-(MI-hPG)-CuNPs (c). FITC-BSA adsorption was tested on PCL (d), PCL-(MI-hPG) (e), and PCL-(MI-hPG)-CuNPs (f). The corresponding quantitative measurements of bacteria attachment via DAPI staining (g) and FITC-BSA adsorption (h). Statistically significant differences are indicated **p < 0.01 compared with PCL samples.

Fig. 8. Antifouling properties of PCL-(MI-hPG)-CuNPs against E. coli (DH5α). Bacterial viability evaluation was performed by the live/dead backlight bacterial viability kit. Representative images on PCL (a-c), PCL-(MI-hPG) (d-f), and PCL-(MI-hPG)-CuNPs (g-i).

Fig. 9. Biomimetic CuNPs-incorporated PCL surfaces showed improved cell adhesion and proliferation behaviors. The morphologies of CFSE-labeled hMSCs cells after seeding on different surfaces for 4 h, PCL (a), PCL-(MI-hPG) (b), and PCL-(MI-hPG)-CuNPs (c). Quantification of the adherent CFSE-labeled hMSCs cells, fluorescence density was normalized to that of PCL samples (g). Live/dead stain of the cells after seeding on the surface of fibers for 3 days, PCL (d), PCL-(MI-hPG) (e), and PCL-(MI-hPG)-CuNPs (f). Cell proliferation of hMSCs on different surfaces tested via MTT (h). Data are presented as the mean ± SD, n = 4. Statistically significant differences are indicated *p < 0.05 and **p < 0.01 compared with PCL samples.

Fig. 10. Biomimetic CuNPs-incorporated PCL surfaces exhibited enhanced osteogenesis compared to the untreated surfaces in the osteogenic differentiation medium. Representative images of ALP staining of hMSCs cultured on different surfaces after 14 days, PCL (a), PCL-(MI-hPG) (b), and PCL-(MI-hPG)-CuNPs (c). Representative images of Alizarin Red S staining after 28 days, PCL (e), PCL-(MI-hPG) (f), and PCL-(MI-hPG)-CuNPs (g). Quantitative ALP activity of hMSCs after 14 days of culture in osteogenic differentiation medium (d). Quantification of the Alizarin Red S stained mineral layer, dissolved in 5% formic acid solution, determined using a plate reader (h). Osteoblast-related gene expressions of ALP (i) and RUNX2 (j) on different surfaces. The data were generated by qRT-PCR and presented as relative to control cells cultured in PCL by using normalization against a GAPDH reference. Data are presented as the mean ± SD, n = 4. Statistically significant differences are indicated *p < 0.05 and **p < 0.01 compared with PCL samples.

References 64

[1]	Y. Shi, L. Wang, Y. Niu, N. Yu, P. Xing, L. Dong, C. Wang, Adv. Funct. Mater., 28 (2018), 1804483.
[2]	J. Min, K.Y. Choi, E.C. Dreaden, R.F. Padera, R.D. Braatz, M. Spector, P.T. Hammond, ACS Nano, 10 (2016), pp. 4441-4450. DOI URL
[3]	J. Li, L. Tan, X. Liu, Z. Cui, X. Yang, K.W.K. Yeung, P.K. Chu, S. Wu, ACS Nano, 11 (2017), pp. 11250-11263. DOI URL
[4]	A. Mathew, C. Vaquette, S. Hashimi, I. Rathnayake, F. Huygens, D.W. Hutmacher, S. Ivanovski, Adv. Healthc. Mater., 6 (2017), 1601345.
[5]	P. Mostafalu, G. Kiaee, G. Giatsidis, A. Khalilpour, M. Nabavinia, M.R. Dokmeci, S. Sonkusale, D.P. Orgill, A. Tamayol, A. Khademhosseini, Adv. Funct. Mater., 27 (2017), 1702399.
[6]	A. Nasajpour, S. Ansari, C. Rinoldi, A.S. Rad, T. Aghaloo, S.R. Shin, Y.K. Mishra, R. Adelung, W. Swieszkowski, N. Annabi, A. Khademhosseini, A. Moshaverinia, A. Tamayol, Adv. Funct. Mater., 28 (2018), 1703437.
[7]	C.R. Arciola, D. Campoccia, L. Montanaro, Nat. Rev. Microbiol., 16 (2018), pp. 397-409. DOI URL
[8]	M. Cloutier, D. Mantovani, F. Rosei, Trends Biotechnol., 33 (2015), pp. 637-652. DOI URL
[9]	H.C. Flemming, J. Wingender, Nat. Rev. Microbiol., 8 (2010), pp. 623-633. DOI URL
[10]	S. Swar, V. Máková, J. Horáková, P. Kejzlar, P. Parma, I. Stibor, Eur. Polym. J., 122 (2020), 109392. DOI URL
[11]	I. Banerjee, R.C. Pangule, R.S. Kane, Adv. Mater., 23 (2011), pp. 690-718. DOI URL
[12]	H.C. Hung, P. Jain, P. Zhang, F. Sun, A. Sinclair, T. Bai, B. Li, K. Wu, C. Tsao, E.J. Liu, Adv. Mater., 29 (2017), 1700617. DOI URL
[13]	L. Hall-Stoodley, J.W. Costerton, P. Stoodley, Nat. Rev. Microbiol., 2 (2004), pp. 95-108. PMID
[14]	H. Koo, R.N. Allan, R.P. Howlin, P. Stoodley, L. Hall-Stoodley, Nat. Rev. Microbiol., 15 (2017), pp. 740-755. DOI URL
[15]	J. Raphel, M. Holodniy, S.B. Goodman, S.C. Heilshorn, Biomaterials, 84 (2016), pp. 301-314. DOI URL
[16]	C. Zhang, Y. Ou, W.X. Lei, L.S. Wan, J. Ji, Z.K. Xu, Angew. Chem. Int. Ed., 128 (2016), pp. 3106-3109. DOI URL
[17]	T.S. Sileika, H.D. Kim, P. Maniak, P.B. Messersmith, ACS Appl. Mater. Interfaces, 3 (2011), pp. 4602-4610. DOI URL
[18]	C. Mao, Y. Xiang, X. Liu, Z. Cui, X. Yang, K.W.K. Yeung, H. Pan, X. Wang, P.K. Chu, S. Wu, ACS Nano, 11 (2017), pp. 9010-9021. DOI URL
[19]	G. Pan, S. Sun, W. Zhang, R. Zhao, W. Cui, F. He, L. Huang, S.H. Lee, K.J. Shea, Q. Shi, H. Yang, J. Am. Chem. Soc., 138 (2016), pp. 15078-15086. DOI URL
[20]	M. Li, C. Schlaich, M.W. Kulka, I.S. Donskyi, T. Schwerdtle, W.E.S. Unger,, R. Haag, J. Mater. Chem. B, 7 (2019), pp. 3438-3445. DOI URL
[21]	Q. Wei, T. Becherer, P.L. Noeske, I. Grunwald, R. Haag, Adv. Mater., 26 (2014), pp. 2688-2693. DOI URL
[22]	B.P. Lee, P.B. Messersmith, J.N. Israelachvili, J.H. Waite, Annu. Rev. Mater. Res., 41 (2011), pp. 99-132. DOI URL
[23]	Q. Wei, S. Krysiak, K. Achazi, T. Becherer, P.L. Noeske, F. Paulus, H. Liebe, I. Grunwald, J. Dernedde, A. Hartwig, T. Hugel, R. Haag, Colloids Surf. B-Biointerfaces, 122 (2014), pp. 684-692. DOI URL
[24]	H. Lee, S.M. Dellatore, W.M. Miller, P.B. Messersmith, Science, 318 (2007), pp. 426-430. DOI URL
[25]	C. Schlaich, M. Li, C. Cheng, I.S. Donskyi, L. Yu, G. Song, E. Osorio, Q. Wei, R. Haag, Adv. Mater. Interfaces, 5 (2018), 1701254. DOI URL
[26]	C. Schlaich, Q. Wei, R. Haag, Langmuir, 33 (2017), pp. 9508-9520. DOI URL
[27]	C. Schlaich, L.C. Camacho, L. Yu, K. Achazi, Q. Wei, R. Haag, ACS Appl. Mater. Interfaces, 8 (2016), pp. 29117-29127. DOI URL
[28]	E.J. Tobin, Adv. Drug Deliv. Rev., 112 (2017), pp. 88-100. DOI URL
[29]	H.D. Kim, S. Amirthalingam, S.L. Kim, S.S. Lee, J. Rangasamy, N.S. Hwang, Adv. Healthc. Mater., 6 (2017), 1700612. DOI URL
[30]	E.A. Makris, A.H. Gomoll, K.N. Malizos, J.C. Hu, K.A. Athanasiou, Nat. Rev. Rheumatol., 11 (2015), pp. 21-34. DOI URL
[31]	G.S. Hussey, J.L. Dziki, S.F. Badylak, Nat. Rev. Mater., 3 (2018), pp. 159-173. DOI URL
[32]	X. Hu, Y. Wang, Y. Tan, J. Wang, H. Liu, Y. Wang, S. Yang, M. Shi, S. Zhao, Y. Zhang, Q. Yuan, Adv. Mater., 29 (2017), 1605235. DOI URL
[33]	S.J. Lee, D. Lee, T.R. Yoon, H.K. Kim, H.H. Jo, J.S. Park, J.H. Lee, W.D. Kim, I.K. Kwon, S.A. Park, Acta Biomater., 40 (2016), pp. 182-191. DOI URL
[34]	X. Wang, S. Li, C. Yan, P. Liu, J. Ding, Nano Lett., 15 (2015), pp. 1457-1467. DOI URL
[35]	E. O’Neill, G. Awale, L. Daneshmandi, O. Umerah, K.W.H. Lo, Drug Discov. Today, 23 (2018), pp. 879-890. DOI URL
[36]	S.J. Lam, N.M. O’Brien-Simpson, N. Pantarat, A. Sulistio, E.H. Wong, Y.Y. Chen, J.C. Lenzo, J.A. Holden, A. Blencowe, E.C. Reynolds, G.G. Qiao, Nat. Microbiol., 1 (2016), p. 16162. DOI URL
[37]	R. Joseph, A. Naugolny, M. Feldman, I.M. Herzog, M. Fridman, Y. Cohen, J. Am. Chem. Soc., 138 (2016), pp. 754-757. DOI URL
[38]	E.H. Schwab, T.L.M. Pohl, T. Haraszti, G.K. Schwaerzer, C. Hiepen, J.P. Spatz, P. Knaus, E.A. Cavalcanti-Adam, Nano Lett., 15 (2015), pp. 1526-1534. DOI URL
[39]	T. Ren, M. Yang, K. Wang, Y. Zhang, J. He, ACS Appl. Mater. Interfaces, 10 (2018), pp. 25717-25725. DOI URL
[40]	Y. Yan, J. Zhang, L. Ren, C. Tang, Chem. Soc. Rev., 45 (2016), pp. 5232-5263. DOI PMID
[41]	M.C. Linder, M. Hazegh-Azam, Am. J. Clin. Nutr., 63 (1996), pp. 797s-811s.
[42]	Y.N. Slavin, J. Asnis, U.O. Häfeli, H. Bach, J. Nanobiotechnol., 15 (2017), p. 65. DOI PMID
[43]	L.P. Arendsen, R. Thakar, A.H. Sultan, Clin. Microbiol. Rev., 32 (2019), pp. e00125-00118.
[44]	Y. Lu, L. Li, Y. Zhu, X. Wang, M. Li, Z. Lin, X. Hu, Y. Zhang, Q. Yin, H. Xia, C. Mao, ACS Appl. Mater. Interfaces, 10 (2018), pp. 127-138. DOI URL
[45]	M. Li, L. Nan, D. Xu, G. Ren, K. Yang, J. Mater. Sci. Technol., 31 (2015), pp. 243-251.
[46]	X. Zhang, C. Yang, K. Yang, ACS Appl. Mater. Interfaces, 12 (2019), pp. 361-372. DOI URL
[47]	S.J. Hollister, Nat. Mater., 4 (2005), p. 518. PMID
[48]	G. Yang, X. Li, Y. He, J. Ma, G. Ni, S. Zhou, Prog. Polym. Sci., 81 (2018), pp. 80-113. DOI URL
[49]	X. Shi, L. Li, S. Ostrovidov, Y. Shu, A. Khademhosseini, H. Wu, ACS Appl. Mater. Interfaces, 6 (2014), pp. 11915-11923. DOI URL
[50]	M.M. Hasani-Sadrabadi, P. Sarrion, N. Nakatsuka, T.D. Young, N. Taghdiri, S. Ansari, T. Aghaloo, S. Li, A. Khademhosseini, P.S. Weiss, Moshaverinia ACS Nano, 13 (2019), pp. 3830-3838.
[51]	S.J. Lee, D. Lee, T.R. Yoon, H.K. Kim, H.H. Jo, J.S. Park, J.H. Lee, W.D. Kim, I.K. Kwon, S.A. Park, Acta Biomater., 40 (2016), pp. 182-191. DOI URL
[52]	A. Andukuri, M. Kushwaha, A. Tambralli, J.M. Anderson, D.R. Dean, J.L. Berry, Y.D. Sohn, Y.S. Yoon, B.C. Brott, H.W. Jun, Acta Biomater., 7 (2011), pp. 225-233. DOI URL
[53]	Q. Yu, Y. Han, X. Wang, C. Qin, D. Zhai, Z. Yi, J. Chang, Y. Xiao, C. Wu, ACS Nano, 12 (2018), pp. 2695-2707. DOI URL
[54]	A.R.K. Sasikala, A.R. Unnithan, R.G. Thomas, S.W. Ko, Y.Y. Jeong, C.H. Park, C.S. Kim, Adv. Funct. Mater., 28 (2018), 1704793. DOI URL
[55]	C.P. Randall, A. Gupta, N. Jackson, D. Busse, A.J. O’Neill, J. Antimicrob. Chemother., 70 (2015), pp. 1037-1046.
[56]	Q. Wei, R. Haag, Mater. Horiz., 2 (2015), pp. 567-577. DOI URL
[57]	G.L. Mchugh, R. Moellering, C. Hopkins, M. Swartz, Lancet, 305 (1975), pp. 235-240. DOI URL
[58]	T.M. Nguyen, A. Arthur, R. Panagopoulos, S. Paton, J.D. Hayball, A.C. Zannettino, L.E. Purton, K. Matsuo, S. Gronthos, Stem Cells, 33 (2015), pp. 2838-2849. DOI PMID
[59]	C. Chen, I. Ahmed, L. Fruk, Nanoscale, 5 (2013), pp. 11610-11614. DOI URL
[60]	J. Zhang, W. Chen, L. Yu, M. Li, F. Neumann, W. Li, R. Haag, ACS Appl. Nano Mater., 1 (2018), pp. 1513-1521. DOI URL
[61]	M. Li, L. Gao, C. Schlaich, J. Zhang, I.S. Donskyi, G. Yu, W. Li, Z. Tu, J. Rolff, T. Schwerdtle, R. Haag, N. Ma, ACS Appl. Mater. Interfaces, 9 (2017), pp. 35411-35418. DOI URL
[62]	C. Pal, K. Asiani, S. Arya, C. Rensing, D.J. Stekel, D.J. Larsson, J.L. Hobman, Adv. Microb. Physiol., 70 (2017), pp. 261-313.
[63]	J. Zhang, C. Cheng, J.L. Cuellar-Camacho, M. Li, Y. Xia, W. Li, R. Haag, Adv. Funct. Mater., 28 (2018), p. 1804773. DOI URL
[64]	Y. Xia, S. Li, C. Nie, J. Zhang, S. Zhou, H. Yang, M. Li, W. Li, C. Cheng, R. Haag, Appl. Mater. Today, 16 (2019), pp. 518-528. DOI PMID