Improved osteointegration and angiogenesis of strontium-incorporated 3D-printed tantalum scaffold via bioinspired polydopamine coating

doi:10.1016/j.jmst.2020.08.017

Abstract

Abstract:

Tantalum (Ta) is used in orthopedic implants because it has excellent biocompatibility. However, high elastic modulus, bio-inertness, and unsatisfactory osteointegration limits its wider use in clinical applications. Herein, a 3D porous Ta scaffold with low elastic modulus was fabricated using selective laser melting (SLM). Strontium (Sr) was incorporated on the surface of the scaffold with the aid of polydopamine (PDA) to further improve its osteointegration ability. The prepared scaffolds exhibited a stable Sr ion release in 14 d. Rat bone marrow stem cells (BMSCs) showed improved early adhesion and spreading after Sr was incorporated on the porous Ta surface. The osteogenic behavior, including extracellular matrix mineralization (ECM), alkaline phosphatase activity (ALP), and expression of bone-related RNA, were all enhanced. Furthermore, the Sr-incorporated porous Ta scaffolds exhibited better angiogenic behavior, such as promoting migration, tube formation, and angiogenesis-related RNA expression abilities of human vascular endothelial cells (HUVECs). Additionally, histological images (H&E, Masson and CD31 immunofluorescent staining) suggested that Sr-incorporated porous Ta scaffolds displayed enhanced osteointegration and angiogenesis after implantation in rat femur for 12 weeks. These findings prove that the PDA-based Sr-incorporated porous Ta scaffolds show promising use in orthopedic implants.

Key words: 3D Ta scaffold, Strontium, Osteogenesis, Angiogenesis, Orthopedic implant

Shi Cheng, Jin Ke, Mengyu Yao, Hongwei Shao, Jielong Zhou, Ming Wang, Xiongfa Ji, Guoqing Zhong, Feng Peng, Limin Ma, Yu Zhang. Improved osteointegration and angiogenesis of strontium-incorporated 3D-printed tantalum scaffold via bioinspired polydopamine coating[J]. J. Mater. Sci. Technol., 2021, 69: 106-118.

Figures/Tables 10

Table 1 The primer sequences used in RT-PCR.

Gene	Forward primer sequence(5’-3’)	Reverse primer sequence(3’-5’)
ALP	CGTCTCCATGGTGGATTATGCT	CCCAGGCACAGTGGTCAAG
RUNX-2	GGGACCGACACAGCCATATA	TCTTAGGGTCTCGGAGGGAA
Col-1	CTGCCCAGAAGAATATGTATCACC	GAAGCAAAGTTTCCTCCAAGACC
OCN	GCCCTGACTGCATTCTGCCTCT	TCACCACCTTACTGCCCTCCTG
KDR	AGCAGGATGGCAAAGACTAC	TACTTCCTCCTCCTCCATACAG
VEGF	CAGGACATTGCTGTGCTTTG	CTCAGAAGCAGGTGAGAGTAAG
HIF-α	TCTACCAGTTGCAGCCTGAC	GTTCCCTTCCTCCTTGATTT
GAPDH(rat)	ACAGCAACAGGGTGGTGGAC	TTTGAGGGTGCAGCGAACTT
GAPDH(human)	CAAGAGCACAAGAGGAAGAGAG	CTACATGGCAACTGTGAGGAG

Fig. 1. Surface views (a) and optical images (b) of PT, PTD, and PTD-Sr samples. Accumulative release of Sr concentration for PTD-Sr samples after immersion in PBS for 14 d (c). High resolution of N 1s (d) and Sr 3d (e) of PTD and PTD-Sr2 samples.

Fig. 2. Early adhesion of rBMSCs after stimulation with various extracts for 4 h (a) and results of quantitative analysis (b). Proliferation of rBMSCs after culture on sample surfaces for different points in time (c).

Fig. 3. Live/Dead staining of rBMSCs after direct culture on sample surfaces for 3 d (a). SEM images of rBMSCs after culture on various sample surfaces for 3 d (b).

Fig. 4. In vitro osteogenic differentiation tests. Alizarin red staining (a) and ALP staining (b) of rBMSCs after stimulation with various extracts for 14 and 21 d. Corresponding quantitative results of Alizarin red staining and ALP activity (c, d). RT-PCR results for osteogenic related genes of rBMSCs after culture on various sample surfaces for 7 d (e) and 14 d (f).

Fig. 5. In vitro angiogenic tests. Results for tube formation assay of HUVECs after stimulation with sample extracts (a) and the quantitative tube lengths (c). Results for wound healing assay of HUVECs after culture with extracts for 12 h (b) and the corresponding percentage of migration (d).

Fig. 6. Results of Transwell assay (a) and count of migrated HUVECs number (b). Secretion of VEGF protein of HUVECs directly cultured on samples (c). RT-PCR results of angiogenic related genes after culture on various sample surfaces for 7 d (d) and 14 d (e).

Fig. 7. Histological observations. HE stains of PT, PTD, and PTD-Sr 2 after implantation in rat femur condyles for 8 and 12 weeks. The blue arrows indicate the newborn osseous tissues grow into the scaffolds at low magnification. The yellow pentagrams indicate the new bone area in each scaffold and the yellow squares indicate the implant at high magnification.

Fig. 8. Masson staining of PT, PTD, and PTD-Sr 2 after implantation in rat femur condyles for 8 and 12 weeks. The blue arrows indicate the newborn osseous tissues grow into the scaffolds at low magnification. The yellow pentagrams indicate the new bone area in each scaffold and the yellow squares indicate the implant at high magnification.

Fig. 9. Observation of in vivo angiogenesis. CD31 and DAPI immunofluorescent staining for histological slices of PT, PTD, and PTD-Sr 2 after implantation in rat femur condyles for 12 weeks. Arrow indicates the new growth vessels.

References 48

[1]	H. Yuan, H. Fernandes, P. Habibovic, J. de Boer, A.M.C. Barradas, A. de Ruiter, W.R. Walsh, C.A. van Blitterswijk, J.D. de Bruijn, Proc. Natl. Acad. Sci. U.S.A. 107 (2010) 13614-13619. DOI URL
[2]	W. Tang, D. Lin, Y. Yu, H. Niu, H. Guo, Y. Yuan, C. Liu, Acta Biomater. 32 (2016) 309-323. DOI PMID
[3]	T. Takizawa, N. Nakayama, H. Haniu, K. Aoki, M. Okamoto, H. Nomura, M. Tanaka, A. Sobajima, K. Yoshida, T. Kamanaka, K. Ajima, A. Oishi, C. Kuroda, H. Ishida, S. Okano, S. Kobayashi, H. Kato, N. Saito, Adv. Mater. 30 (2018), 1703608. DOI URL
[4]	Y. Liu, C. Bao, D. Wismeijer, G. Wu, Mater. Biol. Appl. 49 (2015) 323-329.
[5]	J.D. Bobyn, R.A. Poggie, J.J. Krygier, D.G. Lewallen, A.D. Hanssen, R.J. Lewis, A.S. Unger, T. J.O’Keefe, M.J. Christie, S. Nasser, J.E. Wood, S.D. Stulberg, M. Tanzer, J. Bone Joint Surg.-Am. Vol. 86A (2004) 123-129.
[6]	M. Niinomi, M. Nakai, J. Hieda, Acta Biomater. 8 (2012) 3888-3903. DOI PMID
[7]	Y. Zhang, L. Li, Z.J. Shi, J. Wang, Z.H. Li, Eur. J. Orthop. Surg. Traumatol. 23 (2013) 211-217. DOI URL
[8]	M. Stiehler, M. Lind, T. Mygind, A. Baatrup, A. Dolatshahi-Pirouz, H. Li, M. Foss, F. Besenbacher, M. Kassem, C. Bunger, J. Biomed. Mater. Res. A 86 (2008) 448-458. PMID
[9]	Z. Tang, Y. Xie, F. Yang, Y. Huang, C. Wang, K. Dai, X. Zheng, X. Zhang, PloS one 8 (2013), e66263. DOI URL
[10]	L. Wang, X. Hu, X. Ma, Z. Ma, Y. Zhang, Y. Lu, X. Li, W. Lei, Y. Feng, Colloids Surf. B: Biointerfaces 148 (2016) 440-452. DOI URL
[11]	X. Li, L. Wang, X. Yu, Y. Feng, C. Wang, K. Yang, D. Su, Mater. Sci. Eng. C 33 (2013) 2987-2994. DOI URL
[12]	H. Matsuno, A. Yokoyama, F. Watari, M. Uo, T. Kawasaki, Biomaterials 22 (2001) 1253-1262. PMID
[13]	R. Wauthle, J. van der Stok, S.Amin Yavari, J. Van Humbeeck, J.P. Kruth, A.A. Zadpoor, H. Weinans, M. Mulier, J. Schrooten, Acta Biomater. 14 (2015) 217-225.
[14]	M. Lu, X. Zhuang, K. Tang, P. Wu, X. Guo, L. Yin, H. Cao, D. Zou, Cellular Phys. Biochem. 51 (2018) 589-609.
[15]	J. Nagels, M. Stokdijk, P.M. Rozing, J. Shoulder Elbow Surg. 12 (2003) 35-39. DOI URL
[16]	W.D. Bugbee, W.J. Culpepper, C.A. Engh, C.A. Engh, J. Bone Joint Surg.-Am. 79A (1997) 1007-1012.
[17]	D.R. Sumner, J. Biomech. 48 (2015) 797-800. DOI PMID
[18]	V. Karageorgiou, D. Kaplan, Biomaterials 26 (2005) 5474-5491. PMID
[19]	L.W. Lin, Y.F. Fang, Y.X. Liao, G. Chen, C.X. Gao, P.Z. Zhu, Adv. Eng. Mater. 21 (2019), 1801013. DOI URL
[20]	Y. Guo, K. Xie, W. Jiang, L. Wang, G. Li, S. Zhao, W. Wu, Y. Hao, ACS Biomater. Sci. Eng. 5 (2018) 1123-1133. DOI URL
[21]	J. Qin, Q. Chen, C. Yang, Y. Huang, J. Alloys Compd. 654 (2016) 39-44. DOI URL
[22]	K.C. Nune, S. Li, R.D.K. Misra, Sci. China Mater. 61 (2017) 455-474. DOI URL
[23]	H. Ma, T. Li, Z. Huan, M. Zhang, Z. Yang, J. Wang, J. Chang, C. Wu, NPG Asia Mater. 10 (2018) 31-44. DOI URL
[24]	A.P. Kusumbe, S.K. Ramasamy, R.H. Adams, Nature 507 (2014) 323-328. DOI PMID
[25]	C.J. Percival, J.T. Richtsmeier, Develop. Dynamics 242 (2013) 909-922. DOI URL
[26]	H. Xie, Z. Cui, L. Wang, Z.Y. Xia, Y. Hu, L.L. Xian, C.J. Li, L. Xie, J. Crane, M. Wan, G.H. Zhen, Q. Bian, B. Yu, W.Z. Chang, T. Qiu, M. Pickarski, L.T. Duong, J.J. Windle, X.H. Luo, E.Y. Liao, X. Cao, Nat. Med. 20 (2014) 1270-1278. DOI URL
[27]	S.E. Kim, Y.P. Yun, J.Y. Lee, J.S. Shim, K. Park, J.B. Huh, J. Tissue Eng. Regener. Med. E 9 (2015) 219-228.
[28]	H. Schliephake, C. Botel, A. Forster, B. Schwenzer, J. Reichert, D. Scharnweber, Biomaterials 33 (2012) 1315-1322. DOI PMID
[29]	A.M. Nair, Y.T. Tsai, K.M. Shah, J. Shen, H. Weng, J. Zhou, X. Sun, R. Saxena, J. Borrelli, L. Tang, Biomaterials 34 (2013) 7364-7371. DOI URL
[30]	J. Zhou, L. Zhao, Sci. Rep. 6 (2016) 29069. DOI URL
[31]	Y. Yu, G. Jin, Y. Xue, D. Wang, X. Liu, J. Sun, Acta Biomater. 49 (2017) 590-603. DOI URL
[32]	J.J. Li, C.R. Dunstan, A. Entezari, Q. Li, R. Steck, S. Saifzadeh, A. Sadeghpour, J.R. Field, A. Akey, M. Vielreicher, O. Friedrich, S.I. Roohani-Esfahani, H. Zreiqat, Adv. Health Mater. 8 (2019), e1801298.
[33]	H.Y. Zhu, D. Zhai, C.C. Lin, Y.L. Zhang, Z.G. Huan, J. Chang, C.T. Wu, J. Mater. Chem. B 4 (2016) 6200-6212. DOI URL
[34]	L. Mao, L. Xia, J. Chang, J. Liu, L. Jiang, C. Wu, B. Fang, Acta Biomater. 61 (2017) 217-232. DOI URL
[35]	S.P. Nielsen, Bone 35 (2004) 583-588. PMID
[36]	L. Cianferotti, F. D’Asta, M.L. Brandi, Therap. Adv. Musculoskeletal Disease 5 (2013) 127-139. DOI URL
[37]	W.J. Zhang, H.L. Cao, X.C. Zhang, G.L. Li, Q. Chang, J. Zhao, Y.Q. Qiao, X. Ding, G.Z. Yang, X.Y. Liu, X.Q. Jiang, Nanoscale 8 (2016) 5291-5301. DOI URL
[38]	F. Zhao, B. Lei, X. Li, Y. Mo, R. Wang, D. Chen, X. Chen, Biomaterials 178 (2018) 36-47. DOI URL
[39]	L. Jia, F. Han, H. Wang, C. Zhu, Q. Guo, J. Li, Z. Zhao, Q. Zhang, X. Zhu, B. Li, J. Orthop. Translat. 17 (2019) 82-95. DOI URL
[40]	Z. Wei, P. Tian, X. Liu, B. Zhou, Colloids Surf. B: Biointerfaces 121 (2014) 451-460. DOI URL
[41]	H. Li, F. Peng, D. Wang, Y. Qiao, D. Xu, X. Liu, Biomater. Sci. 6 (2018) 1846-1858. DOI URL
[42]	J. Ryu, S.H. Ku, H. Lee, C.B. Park, Adv. Funct. Mater. 20 (2010) 2132-2139. DOI URL
[43]	X. Gao, J.L. Song, P. Ji, X.H. Zhang, X.M. Li, X. Xu, M.K. Wang, S.Q. Zhang, Y. Deng, F. Deng, S.C. Wei, ACS Appl. Mater. Interfaces 8 (2016) 3499-3515. DOI URL
[44]	D.D. Xia, Y. Liu, S.Y. Wang, R.C. Zeng, Y.S. Liu, Y.F. Zheng, Y.S. Zhou, Sci. China Mater. 62 (2019) 256-272. DOI URL
[45]	L.Y. Cui, L. Sun, R.C. Zeng, Y.F. Zheng, S.Q. Li, Sci China Mater. 61 (2018) 607-618. DOI URL
[46]	L. Ma, X. Wang, N. Zhao, Y. Zhu, Z. Qiu, Q. Li, Y. Zhou, Z. Lin, X. Li, X. Zeng, H. Xia, S. Zhong, Y. Zhang, Y. Wang, C. Mao, ACS Appl. Mater. Interfaces 10 (2018) 42146-42154. DOI URL
[47]	C. Wu, P. Han, X. Liu, M. Xu, T. Tian, J. Chang, Y. Xiao, Acta Biomater. 10 (2014) 428-438. DOI URL
[48]	H. Ma, J. Luo, Z. Sun, L. Xia, M. Shi, M. Liu, J. Chang, C. Wu, Biomaterials 111 (2016) 138-148. DOI URL