Mg-Fe LDH sealed PEO coating on magnesium for biodegradation control, antibacteria and osteogenesis

doi:10.1016/j.jmst.2021.05.088

Abstract

Abstract:

Attempt of developing bio-safety and functional layered double hydroxides (LDHs) modified plasma electrolytic oxidation (PEO) coatings, has become a hotspot in the protection of magnesium (Mg) based biomedical implants. In the present work, Mg-Fe LDH films with different Fe contents were fabricated on PEO coating via a novel two-step method: firstly, the FeOOH films were prepared by immersing PEO sample in Fe²⁺-containing solution, and then Mg-Fe LDH films were formed by transforming the FeOOH films via a hydrothermal treatment in water. The highly-oriented LDH nano-sheets could enhance the anti-corrosion performance of PEO coating, which was proved by the results of electrochemical test, hydrogen evolution and corroded morphology. PEO/Mg-Fe LDH coatings showed a low hemolysis rate (less 5%) than PEO coating. In addition, PEO/Mg-Fe LDH coatings were more favorable for cell adhesion and proliferation than PEO coating. Moreover, PEO/Mg-Fe LDH coatings showed good photothermal conversion property, which demonstrated the excellent rapid antibacterial effect under NIR light. In vitro culture of rat bone marrow stem cell (rBMSC) suggested that cells cultured in the extract of PEO/Mg-Fe LDH coatings had a better osteogenic activity. In vivo subcutaneous implantation test revealed that PEO/Mg-Fe LDH coatings exhibited good anti-corrosion and histocompatibility.

Key words: Magnesium, Plasma electrolytic oxidation, Layered double hydroxide, Anti-corrosion, Anti-bacteria, Osteogenesis

Dongdong Zhang, Jielong Zhou, Feng Peng, Ji Tan, Xianming Zhang, Shi Qian, Yuqin Qiao, Yu Zhang, Xuanyong Liu. Mg-Fe LDH sealed PEO coating on magnesium for biodegradation control, antibacteria and osteogenesis[J]. J. Mater. Sci. Technol., 2022, 105: 57-67.

Figures/Tables 11

Fig. 1. Diagram of preparation process of PEO/Mg-Fe LDH composite coating.

Table 1. Primer sequences used in RT-PCR

Gene	Forward primer sequence (5′-3′)	Reverse primer sequence (3′-5′)
ALP	ACTCAGGGCAATGAGGTCAC	CACCCGAGTGGTAGTCACAA
OCN	AGACTCCGGCGCTACCTT	CTCGTCACAAGCAGGGTTAAG
Runx2	GACTGTGGTTACCGTCATGGC	ACTTGGTTTTTCATAACAGCGGA
GAPDH(Rat)	TGTCCGTCGTGGATCTGAC	CCTGCTTCACCACCTTCTTG

Fig. 2. Surface morphologies, cross-sectional images, EDS spectra of the PEO (a, d, g), LDH-Fe1 (b, e, h), and LDH-Fe2 samples (c, f, i).

Fig. 3. XRD patterns of all the samples (a); Infrared spectra of the powder scraped from the LDH-Fe1 and LDH-Fe2 samples (b); XPS survey spectrum (c) and high-resolution XPS spectra for Fe 2p (d) and O 1s (e) of the LDH-Fe2 sample.

Fig. 4. SEM surface views, EDS spectra and elemental mappings, and XRD patterns (a1-a5) of the PEO-Fe1 and PEO-Fe2 samples; Raman spectrum (a6) and high-resolution XPS spectra for Fe 2p (a7) and O 1s (a8) of the PEO-Fe2 sample; Possible formation mechanism of Mg-Fe LDH on PEO coating (b).

Fig. 5. Potentiodynamic polarization curves (a), EIS curves and fitted equivalent circuit (b, c), hydrogen release tests (d), and corrosion morphologies (e) of the various samples.

Table 2. Corrosion current density (jcorr) and fitted parameters of EIS spectra of all the samples.

	j_corr (A cm^-2)	R_s (Ω cm²)	Q_f (Ω^-1 cm^-2 s^-ⁿ)	n_f	R_f (Ω cm²)	Q_dl (Ω^-1 cm^-2 s^-ⁿ)	n_dl	R_ct (Ω cm²)
PEO	8.63 × 10^-7	8.6	7.336 × 10^-6	1.000	618	1.267 × 10^-4	0.7019	262.1
LDH-Fe1	2.13 × 10^-8	10.2	4.194 × 10^-8	0.955	1652	5.799 × 10^-6	0.9824	310.4
LDH-Fe2	2.17 × 10^-8	19.6	5.105 × 10^-8	1.000	1725	9.670 × 10^-6	0.8615	331.4

Fig. 6. CLSM images of F-actin stained with FITC (green) and the nucleus stained with DAPI (blue) of MC3T3-E1 cells cultured on the various samples for 1, 4, and 24 h (a); Fluorescent intensity of alamarBlue reduced by MC3T3-E1 cells cultured on the various samples for 1, 4, and 7 days (b); Fluoroscopy images of live/dead (green/red) staining of MC3T3-E1 cells cultured on the various samples for 4 days (c); Hemolysis ratio of the various samples (d).

Fig. 7. Temperature-time curves (a) and temperature images (b) of all the samples measured in phosphate-buffered saline (PBS) solution under 808 nm irradiation (10 min, 1.2 W/cm-2). In vitro antibacterial investigation (c): representative culture images of bacterial colonies from the samples and corresponding SEM images.

Fig. 8. Quantitative results of ALP activity (a) and corresponding staining images (b), and expression of osteogenesis-related genes of rBMSCs cultured in the extracts of the various samples (c-e).

Fig. 9. SEM surface views (a) and photomicrographs of histological section (b) of the various samples after implantation in rats for 20 and 40 days.

References 34

[1]	X. Li, X.M. Liu, S.L. Wu, K.W.K. Yeung, Y.F. Zheng, P.K. Chu, Acta Biomater. 45 (2016) 2-30. DOI URL
[2]	M. Ali, M. Elsherif, A.E. Salih, A. Ul-Hamid, M.A. Hussein, S. Park, A.K. Yetisen, H. Butt, J. Alloys Compd. 825 (2020) 154140. DOI URL
[3]	J.E. Gray, B. Luan, J. Alloys Compd. 336 (2002) 88-113. DOI URL
[4]	P. Tian, X. Liu, Regen. Biomater. 2 (2015) 135-151. DOI URL
[5]	F. Peng, H. Li, D. Wang, P. Tian, Y. Tian, G. Yuan, D. Xu, X. Liu, ACS Appl. Mater. Interfaces 8 (2016) 35033-35044. DOI URL
[6]	D.D. Zhang, F. Peng, X.Y. Liu, J. Alloys Compd. 853 (2020) 157010. DOI URL
[7]	G.B. Dardand, M. Aliofkhazraei, P. Hamghalam, N. Valizade, J. Magnes. Alloys 5 (2017) 74-132.
[8]	T.S.N.S. Narayanan, I.S. Park, M.H. Lee, Prog. Mater. Sci. 60 (2014) 1-71. DOI URL
[9]	H. Li, F. Peng, D. Wang, Y. Qiao, D. Xu, X. Liu, Biomater. Sci. 6 (2018) 1846-1858. DOI URL
[10]	F. Peng, D.H. Wang, Y.X. Tian, H.L. Cao, Y.Q. Qiao, X.Y. Liu, Sci. Rep. 7 (2017) 8167. DOI URL
[11]	F. Peng, D. Wang, D. Zhang, B. Yan, H. Cao, Y. Qiao, X. Liu, ACS Biomater. Sci. Eng. 4 (2018) 4112-4121. DOI URL
[12]	J. Yu, Q. Wang, D. O’Hare, L. Sun, Chem. Soc. Rev. 46 (2017) 5950-5974. DOI URL
[13]	L. Guo, W. Wu, Y. Zhou, F. Zhang, R. Zeng, J. Zeng, J. Mater. Sci. Technol. 34 (2018) 1455-1466. DOI URL
[14]	S. Li, Y. Shen, D. Liu, L. Fan, X. Zheng, J. Yang, Compos. Interfaces 19 (2013) 489-498. DOI URL
[15]	S. El-Rahman, Pharmacol. Res. 47 (2003) 189-194. PMID
[16]	Y. Liu, Y.F. Zheng, X.H. Chen, J.A. Yang, H.B. Pan, D.F. Chen, L.N. Wang, J.L. Zhang, D.H. Zhu, S.L. Wu, K.W.K. Yeung, R.C. Zeng, Y. Han, S.K. Guan, Adv. Funct. Mater. 29 (2019) 201805452.
[17]	H. Zhang, R.C. Lin, Y.Q. Liu, M. Zhang, D. Zhai, Z.G. Huan, C.T. Wu, ACS Biomater. Sci. Eng. 5 (2019) 6725-6734. DOI URL
[18]	Y.Q. Liu, T. Li, H.S. Ma, D. Zhai, C.J. Deng, J.W. Wang, S.J. Zhuo, J. Chang, C.T. Wu, Acta Biomater. 73 (2018) 531-546. DOI URL
[19]	X.G. Ma, R. Dang, J.Y. Liu, J. Li, Y.H. Kang, Y. Gong, Z.F. Zhang, Y.J. Ma, Compos. Interface 23 (2016) 51-63. DOI URL
[20]	Z. Meng. Y. Zhang, Q. Zhang, X. Chen, L. Liu, S. Komarneni, Appl. Surf. Sci. 396(2016) 799-803. DOI URL
[21]	D.D. Zhang, F. Peng, J. Tan, X.Y. Liu, Appl. Surf. Sci. 496 (2019) 143690. DOI URL
[22]	A. Fattah-alhosseini, R. Chaharmahali, K. Babaei, J. Magnes. Alloys 8 (2020) 799-818.
[23]	K.X. Zhao, H.R. Wang, C.C. Zhu, S.Y. Lin, Z.K. Xu, X.T. Zhang, Electrochim. Acta 308 (2019) 1-8. DOI URL
[24]	D.M. Wu, Z.H. Zou, X.Y. Lu, K.L. Guo, N. Yang, C.L. Xu, J. Mater. Sci. 54 (2019) 10695-10704. DOI URL
[25]	X. Qian, Y. Wu, M. Kan, M. Fang, D. Yue, J. Zeng, Y. Zhao, Appl. Catal. B-Environ. 237 (2018) 513-520. DOI URL
[26]	Y. Yang, X. Zhao, Y. Zhu, F. Zhang, Chem. Mater. 24 (2012) 81-87. DOI URL
[27]	B. Grégoire, C. Ruby, C. Carteret, Dalton Trans 42 (2013) 15687-15698. DOI PMID
[28]	J Wang, F Peng, X.L Wu, D.H. Wang, A. Zheng, L.Y. Cao, C.H. Yu, X.Y. Liu, X.Q. Jiang, Sci. China Mater. 64 (2021) 460-473. DOI URL
[29]	M. Chu, Y. Shao, J. Peng, X. Dai, H. Li, Q. Wu, D. Shi, Biomaterials 34 (2013) 4078-4088. DOI URL
[30]	M. Wang, K. Deng, W. Lü, X. Deng, K. Li, Y. Shi, B. Ding, Z. Cheng, B. Xing, G. Han, Z. Hou, J. Lin, Adv. Mater. 30 (2018) 1706747. DOI URL
[31]	P. Miao, W. Huang, M. Gao, J. Chu, B. Song, P. Xu, ChemCatChem 10 (2018) 1084-1088. DOI URL
[32]	J. Connerade, L.G. Gerchikov, A.N. Ipatov, S. Sentürk, J. Physiol. Biochem. 33 (2000) 5109-5120.
[33]	J. Tan, Z. Liu, D. Wang, X. Zhang, S. Qian, X. Liu, Biomater. Sci. 8 (2020) 1815-1829. DOI URL
[34]	S. Cheng, D. Zhang, M. Li, X. Liu, Y. Zhang, S. Qian, F. Peng, Bioact. Mater. 6 (2021) 91-105. DOI PMID