Rough surface of copper-bearing titanium alloy with multifunctions of osteogenic ability and antibacterial activity

doi:10.1016/j.jmst.2019.12.019

摘要/Abstract

Abstract:

Implant-related infection and early bone integration are the main risk factors of implants for long-term service, to overcome these difficulties, SLA-TiCu surface was prepared by sandblasting and large-grits etching (SLA) treatment on a novel antibacterial titanium-copper alloy (TiCu), which is the most prevalent surface treatment with micro/submicron hierarchical structures to titanium-based implants. Effects of SLA-TiCu surface on the adhesion, proliferation, apoptosis and differentiation of MC3T3-E1 cells as well as the antibacterial activity against a common orthopedic pathogen (Staphylococcus aureus) were studied. Compared to the following surfaces: sandblasting and large-grits etched pure titanium (SLA-Ti), mechanically ground pure titanium and TiCu alloy (M-Ti and M-TiCu), these results indicated that SLA-TiCu surface obviously enhanced the bone-related gene expressions (alkaline phosphates (ALP), collagen type I (COL I), Runt-related transcription factor 2 (RUN × 2), and osteopontin (OPN)). Moreover, SLA-TiCu surface could maintain a sustainable release of Cu²⁺ ions and effectively inhibited the viability of bacteria. This study demonstrated that SLA-TiCu surface possessed multifunctional characteristics of improved osteogenic ability and antibacterial activity, making it promising as a novel implant material for hard tissue repairs such as orthopedics and dental implants.

Key words: Titanium, Copper, Roughness surface, Osteogenesis, Antibacterial

. [J]. 材料科学与技术, 2020, 48(0): 130-139.

Hui Liu, Rui Liu, Ihsan Ullah, Shuyuan Zhang, Ziqing Sun, Ling Ren, Ke Yang. Rough surface of copper-bearing titanium alloy with multifunctions of osteogenic ability and antibacterial activity[J]. J. Mater. Sci. Technol., 2020, 48(0): 130-139.

图/表 14

Table 1 Primer sequences of mouse cells used for RT-qPCR study.

Genes	Primer (5′-3′)
OPN	F: TCTGATGAGACCGTCACTGC
OPN	R: AGGTCCTCATCTGTGGCATC
ALP	F: CCAGCAGGTTTCTCTCTTGG
ALP	R: GGGATGGAGGAGAGAAGGTC
COL I	F: GAGCGGAGAGTACTGGATCG
COL I	R: GTTCGGGCTGATGTACCAGT
Run×2	F: CCCAGCCACCTTTACCTACA
Run×2	R: TATGGAGTGCTGCTGGTCTG
GAPDH	F: ACCCAGAAGACTGTGGATGG
GAPDH	R: CACATTGGGGGTAGGAACAC

Fig. 1. 3D surface profiles of M-Ti, M-TiCu, SLA-Ti and SLA-TiCu.

Table 2 Mean ± one standard deviation (SD) values of roughness (Sa), peak-to-valley height (Sz), developed surface area ratio (Sdr)of different sample surfaces.

Surface	S_a (μm)	S_dr (%)	S_z (μm)
M-Ti	0.22 ± 0.03	6.23 ± 0.14	2.26 ± 0.12
M-TiCu	0.27 ± 0.02	6.45 ± 0.24	2.75 ± 0.09
SLA-Ti	1.73 ± 0.19	73.2 ± 0.56	10.17 ± 0.54
SLA-TiCu	2.06 ± 0.31	97.4 ± 0.64	16.25 ± 0.46

Fig. 2. SEM analysis for the surface and cross section of SLA-Ti (a) and SLA-TiCu (b, b1, b2).

Table 3 Weight concentration of elements in TiCu alloy detected by EDS analysis.

Weight %	Ti	Cu	C	O	Cu/Ti
Point 1	85.77	1.41	6.75	6.07	1.64%
Point 2	69.62	19.78	6.01	4.59	28.41%
Point 3	82.28	7.65	5.98	4.09	9.30%

Fig. 3. Water contact angles with water droplet image (a) and Cu2+ ions concentrations in 0.9% NaCl medium incubated with SLA-TiCu, M-TiCu, respectively (b).

Fig. 4. Proliferation (a) and cell viability (b) of MC3T3-E1 cells cultured on different material surfaces for 1 day, 4 days and 7 days, respectively. *P < 0.05.

Fig. 5. Actin (red) and cell nucleus (blue) fluorescence staining of MC3T3-E1cells (a) and adherent cell densities (b) on the various material surfaces for 1 and 4 days, respectively. **P < 0.05.

Fig. 6. Apoptosis of MC3T3-E1 cells cultured on various material surfaces for 4 and 7 days, respectively.

Fig. 7. Osteogenic differentiation of MC3T3-E1 cells on various material surfaces. ALP activity after cultivating for 4 days and 7days (a) and ARS of the production of the mineralized extracellular matrix of cells for 14 days and 21 days. (b) *P < 0.05; **P < 0.01.

Fig. 8. Bone-related gene expressions of ALP (a), COL I (b), OPN (c) and Run×2 (d) for MC3T3-E1 cells on different surfaces after cultured for 4 days, 7 days and 14 days. *P < 0.05; **P < 0.01.

Fig. 9. Antibacterial rates (a) and Live/Dead fluorescent images of S.aureus (b) on various material surfaces for 1 day.

Fig. 10. Cross sections of SLA-Ti (a) and SLA-TiCu (b) surfaces; Schematic diagrams of formations of SLA-Ti (a1) and SLA-TiCu (b1, b2) morphologies during acid etching process.

Fig. 11. A model of the relationship between proliferation and differentiation during the developmental sequence of MC3T3-E1 cells, the orange arrow representing the osteogenic effect of rough (SLA) surface and the red arrow representing the osteogenic effect of Cu2+ ions, + showing the surface owning observably osteogenic effect and / standing for the surface without significant function, compared with ground surface.

参考文献 53

[1]	M. Weinstein, J. Mccabe, F. Cammisa, J. Spinal Disord. Tech. 13 (2000) 422.
[2]	M. Eitan, C. Ilan, R. Dror, N. Engl. J. Med. 352 (2005) 95-97. URL PMID
[3]	K. Vandamme, X. Holy, M. Bensidhoum, D. Logeart-Avramoglou, I.E. Naert, J.A. Duyck, H. Petite, Biomaterials 32 ( 2011) 3547-3554. URL PMID
[4]	L. Zhao, X. Yan, X. Zhou, L. Zhou, H. Wang, J. Tang, C. Yu, Microporous Mesoporous Mater. 109 (2008) 210-215.
[5]	C. Wu, Y. Zhou, M. Xu, P. Han, L. Chen, J. Chang, Y. Xiao Biomaterials 34 ( 2013) 422-433.
[6]	M. Annunziata, A. Rizzo, C. Leone, C. Mangano, N. Mazzola, L. Nastri, F. Papale, F. Rullo, L. Guida, Surf. Coat. Technol. 328 (2017) 390-397.
[7]	M. Kazemzadeh-Narbat, J. Kindrachuk, K. Duan, H. Jenssen, R.E. Hancock, R. Wang, Biomaterials 31 ( 2010) 9519-9526. URL PMID
[8]	R.I.M. Asri, W.S.W. Harun, M. Samykano, N.A.C. Lah, S.A.C. Ghani, F. Tarlochan, M.R. Raza, Mater. Sci. Eng. C. 77 (2017) 1261-1274.
[9]	R. Hu, C.J. Lin, H.Y. Shi, J. Biomed, Mater. Res., Part A 80 ( 2007) 687-692.
[10]	Y. Shibata, Y. Tanimoto, J. Prosthodont. Res. 59 (2015) 20-33. URL PMID
[11]	A. Wennerberg, L. Sennerby, C. Kultje, U. Lekholm, J. Clin. Periodontol. 30 (2003) 88-94. DOI URL
[12]	A.E. Medvedev, H.P. Ng, R. Lapovok, Y. Estrin, T.C. Lowe, J. Mech. Behav. Biomed. Mater. 57 (2016) 55-68. URL PMID
[13]	L. Le Guehennec, A. Soueidan, P. Layrolle, Y. Amouriq, Dent. Mater. 23 (2007) 844-854. URL PMID
[14]	Y. Kataoka, Y. Tamaki, T. Miyazaki, Biomed. Mater. Eng. 21 (2011) 113-121.
[15]	A. Simchi, E. Tamjid, F. Pishbin, A.R. Boccaccini, Nanomedicine: NBM 7 ( 2011) 22-39.
[16]	L. Zhao, P.K. Chu, Y. Zhang, Z. Wu, J. Biomed, Mater. Res. Part B Appl. Biomater. 91 (2009) 470-480.
[17]	M. Godoy-Gallardo, Z. Wang, Y. Shen, J. Manero, F.J. Gil, D. Rodriguez, M. Haapasalo, ACS Appl. Mater. Interfaces 7 ( 2015) 5992-6001. URL PMID
[18]	M. Cloutier, D. Mantovani, F. Rosei, Trends Biotechnol. 33 (2015) 637-652. DOI URL PMID
[19]	I.M. Shapiro, N.J. Hickok, J. Parvizi, S. Stewart, T.P. Schaer, Eur Cells Mater. 23 (2012) 362-370.
[20]	V. Antoci, C.S. Adams, N.J. Hickok, I.M. Shapiro, J. Parvizi, Clin. Orthop. Relat. Res. 461 (2007) 88-95. URL PMID
[21]	L. Zhao, P.K. Chu, Y. Zhang, Z. Wu, J. Biomed, Mater. Res., Part B 91 ( 2009) 470-480.
[22]	C. Gerard, L.J. Bordeleau, J. Barralet, C.J. Doillon, Biomaterials 31 ( 2010) 824-831. URL PMID
[23]	G. Grass, C. Rensing, M. Solioz, Appl. Environ. Microbiol. 77 (2011) 1541-1547. URL PMID
[24]	L. Ren, K. Yang, L. Guo, H.-w. Chai, Mater. Sci. Eng. C 32 ( 2012) 1204-1209.
[25]	S. Jin, X. Qi, B. Zhang, Z. Sun, B. Zhang, H. Yang, T. Wang, B. Zheng, X. Wang, Q. Shi, M. Chen, L. Ren, K. Yang, H. Zhong, Sci. Rep. 7 (2017) 17394. DOI URL PMID
[26]	Z. Ma, M. Li, R. Liu, L. Ren, Y. Zhang, H. Pan, Y. Zhao, K. Yang, J. Mater, Sci. Mater. Med. 27 (2016) 91.
[27]	R. Liu, K. Memarzadeh, B. Chang, Y. Zhang, Z. Ma, R.P. Allaker, L. Ren, K. Yang, Sci. Rep. 6 (2016) 29985. URL PMID
[28]	C. Peng, S. Zhang, Z. Sun, L. Ren, K. Yang, Mater. Sci. Eng. C 93 ( 2018) 495-504.
[29]	R. Liu, Y. Tang, L. Zeng, Y. Zhao, Z. Ma, Z. Sun, L. Xiang, L. Ren, K. Yang, Dent. Mater. 34 (2018) 1112-1126.
[30]	R. Liu, Z. Ma, S. Kunle Kolawole, L. Zeng, Y. Zhao, L. Ren, K. Yang, J. Mater. Sci. Mater. Med. 30 (2019) 75.
[31]	X. Wang, H. Dong, J. Liu, G. Qin, D. Chen, E. Zhang, Mater. Sci. Eng. C 100 ( 2019) 38-47.
[32]	R.V. Bathomarco, G. Solorzano, C.N. Elias, R. Prioli, Appl. Surf. Sci. 233 (2004) 29-34.
[33]	J.I. Rosales-Leal, M.A. Rodríguez-Valverde, O. García-Martínez, C. Ruizc, M.A. Cabrerizo-Vílchez, Colloids Surf. A Physicochem. Eng. Asp. 365 (2010) 222-229.
[34]	C.N. Elias, Y. Oshida, J.H. Lima, C.A. Muller, J. Mech. Behav. Biomed. Mater. 1 (2008) 234-242. URL PMID
[35]	F. Rupp, R.A. Gittens, L. Scheideler, A. Marmur, B.D. Boyan, Z. Schwartz, J. Geis-Gerstorfer, Acta Biomater. 10 (2014) 2894-2906. URL PMID
[36]	A. Wennerberg, T. Albrektsson, Int. J. Oral Maxillofac. Implants 25 ( 2010) 63-74. URL PMID
[37]	Y. Xie, J. Li, Z.M. Yu, Q. Wei, Mater. Lett. 186 (2017) 38-41.
[38]	A. Wennerberg, T. Albrektsson, Clin. Oral Implants Res. 20 (2009) 72-184.
[39]	G.F. Kennell, R.W. Evitts, K.L. Heppner, Corros. Sci. 50 (2008) 1716-1725.
[40]	B. Vicentini, D. Sinigaglia, G. Taccani, Corros. Sci. 15 (1975) 479-492.
[41]	W.R. Osório, A. Cremasco, P.N. Andrade, A. Garcia, R. Caram, Electrochim. Acta55 (2010) 759-770.
[42]	S. Blatt, A.M. Pabst, E. Schiegnitz, M. Hosang, T. Ziebart, C. Walter, B. Al-Nawas, M.O. Klein, J. Craniomaxillofac. Surg. 46 (2018) 453-460. DOI URL PMID
[43]	S. Jin, X. Qi, T. Wang, L. Ren, K. Yang, H. Zhong, J. Biomed, J. Biomed. Mater. Res. Part B Appl. Biomater. 106 (2018) 561-569.
[44]	M. Jayaraman, U. Meyer, M. Bühner, U. Joos, H.-P. Wiesmann, Biomaterials 25 ( 2004) 625-631. URL PMID
[45]	L.D. Quarles, D.A. Yohay, L.W. Lever, R. Caton, R.J. Wenstrup, J. Bone Miner. Res. 7 (2009) 683-692. URL PMID
[46]	S. Cheng, W. Wang, Z. Lin, P. Zhou, X. Zhang, W. Zhang, Q. Chen, D. Kou, X. Ying, Y. Shen, X. Cheng, Z. Yu, L. Peng, C. Lu, Hum. Cell 26 ( 2013) 114-120. URL PMID
[47]	G. Xiao, D. Jiang, P. Thomas, M.D. Benson, K. Guan, G. Karsenty, R.T. Franceschi, J. Biol. Chem. 275 (2000) 4453-4459. DOI URL PMID
[48]	Marinucci, E. Becchetti, Int. J. Oral Maxillofac. Implants 21 ( 2006) 719-725. URL PMID
[49]	J.P. Rodríguez, M. González, J. Cell. Biochem. 85 (2002) 92-100. URL PMID
[50]	A. Ewald, C. Kappel, E. Vorndran, C. Moseke, M. Gelinsky, U. Gbureck, J. Biomed. Mater. Res. A 100 ( 2012) 2392-2400. URL PMID
[51]	S. Jin, L. Ren, K. Yang, J. Mater. Sci. Technol. 32 (2016) 835-839.
[52]	R.A. Gittens, L. Scheideler, F. Rupp, S.L. Hyzy, J. Geis-Gerstorfer, Z. Schwartz, B.D. Boyan, Acta Biomater. 10 (2014) 2907-2918. DOI URL PMID
[53]	D.R. Drake, J. Paul, J.C. Keller, Int. J. Oral Maxillofac. Implants 14 ( 1999) 226-232. URL PMID