J. Mater. Sci. Technol. ›› 2019, Vol. 35 ›› Issue (11): 2727-2733.DOI: 10.1016/j.jmst.2019.04.028
• Orginal Article • Previous Articles Next Articles
Yonghui Yuanab, Shujing Jinc, Xun Qia, Xudong Chend, Wei Zhangd, Ke Yangc*(), Hongshan Zhonga*()
Received:
2018-12-28
Revised:
2019-03-26
Accepted:
2019-04-04
Online:
2019-11-05
Published:
2019-11-22
Yonghui Yuan, Shujing Jin, Xun Qi, Xudong Chen, Wei Zhang, Ke Yang, Hongshan Zhong. Osteogenesis stimulation by copper-containing 316L stainless steel via activation of akt cell signaling pathway and Runx2 upregulation[J]. J. Mater. Sci. Technol., 2019, 35(11): 2727-2733.
Cr | Ni | Cu | Mo | S | P | Si | C | Fe | |
---|---|---|---|---|---|---|---|---|---|
316 L | 17.7 | 14.2 | <0.01 | 3.09 | 0.005 | 0.005 | 0.03 | 0.007 | Bal. |
316 L-Cu | 17.6 | 14.7 | 3.83 | 3.15 | 0.004 | 0.006 | 0.03 | 0.004 | Bal. |
Table 1 Chemical composition (wt.%) of experimental stainless steels.
Cr | Ni | Cu | Mo | S | P | Si | C | Fe | |
---|---|---|---|---|---|---|---|---|---|
316 L | 17.7 | 14.2 | <0.01 | 3.09 | 0.005 | 0.005 | 0.03 | 0.007 | Bal. |
316 L-Cu | 17.6 | 14.7 | 3.83 | 3.15 | 0.004 | 0.006 | 0.03 | 0.004 | Bal. |
Gene | Sequences (5' → 3') | |
---|---|---|
Forward Primers | Reverse Primers | |
collagen I | GCAACATGGAGACTGGTGAG | GGATGGAGGGAGTTTACAGG |
Runx2 | TCTTCACAAATCCTCCCC | TGGATTAAAAGGACTTGG |
GAPDH | AGCCACATCGCTCAGACAC | GCCCAATACGACCAAATCC |
Table 2 Primer sequences used in RT-qPCR.
Gene | Sequences (5' → 3') | |
---|---|---|
Forward Primers | Reverse Primers | |
collagen I | GCAACATGGAGACTGGTGAG | GGATGGAGGGAGTTTACAGG |
Runx2 | TCTTCACAAATCCTCCCC | TGGATTAAAAGGACTTGG |
GAPDH | AGCCACATCGCTCAGACAC | GCCCAATACGACCAAATCC |
Fig. 1. Cell Counting Kit (CCK)-8 proliferation assay of human fetal osteoblasts (hFOB) cultured on 316L stainless steel (316L SS) and copper-containing 316L stainless steel (316L-Cu SS) for 1, 3 and 7 days, respectively (p > 0.05).
Fig. 2. Apoptosis of human fetal osteoblasts (hFOB) cultured on 316L stainless steel (316L SS) and copper-containing 316L stainless steel (316L-Cu SS) for 1 and 3 days, respectively (p > 0.05).
Fig. 3. Morphologies of human fetal osteoblasts (hFOB) cultured on 316L stainless steel (316L SS) and copper-containing 316L stainless steel (316L-CuSS) for 4 h and 24 h.
Fig. 4. Results of reverse transcriptase-quantitative PCR (RT-qPCR). Relative mRNA expression of collagen I (a), ALP (b) and Runx2 (c) in human fetal osteoblasts (hFOB) cultured on 316L stainless steel (316L SS) and copper-containing 316L stainless steel (316L-Cu SS) for 3 days. #p < 0.05 compared with 316L SS.
Fig. 5. Effect of Akt inhibitor (GSK2141795) on copper-containing 316L stainless steel (316L-Cu SS) induced osteogenesis. Protein expression of Runx2, phospho-Akt and Akt (A); the ratio of phospho-Akt to total Akt (B) and Runx2 to GAPDH (C) were assessed by western blotting. (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001).
Fig. 6. Schematic diagram about “Osteogenesis Stimulation by Copper-containing 316 L Stainless Steel via Activation of Akt Cell Signaling Pathway and Runx2 Upregulation”.
|
[1] | Jiawei Ding, Haitao Wang, En-Hou Han. A multiphysics model for studying transient crevice corrosion of stainless steel [J]. J. Mater. Sci. Technol., 2021, 60(0): 186-196. |
[2] | H. Niu, H.C. Jiang, M.J. Zhao, L.J. Rong. Effect of interlayer addition on microstructure and mechanical properties of NiTi/stainless steel joint by electron beam welding [J]. J. Mater. Sci. Technol., 2021, 61(0): 16-24. |
[3] | Hui Liu, Rui Liu, Ihsan Ullah, Shuyuan Zhang, Ziqing Sun, Ling Ren, Ke Yang. Rough surface of copper-bearing titanium alloy with multifunctions of osteogenic ability and antibacterial activity [J]. J. Mater. Sci. Technol., 2020, 48(0): 130-139. |
[4] | Jiajun Luo, Maryam Tamaddon, Changyou Yan, Shuanhong Ma, Xiaolong Wang, Feng Zhou, Chaozong Liu. Improving the fretting biocorrosion of Ti6Al4V alloy bone screw by decorating structure optimised TiO2 nanotubes layer [J]. J. Mater. Sci. Technol., 2020, 49(0): 47-55. |
[5] | Bassem Barkia, Pascal Aubry, Paul Haghi-Ashtiani, Thierry Auger, Lionel Gosmain, Frédéric Schuster, Hicham Maskrot. On the origin of the high tensile strength and ductility of additively manufactured 316L stainless steel: Multiscale investigation [J]. J. Mater. Sci. Technol., 2020, 41(0): 209-218. |
[6] | Juan Hou, Wei Chen, Zhuoer Chen, Kai Zhang, Aijun Huang. Microstructure, tensile properties and mechanical anisotropy of selective laser melted 304L stainless steel [J]. J. Mater. Sci. Technol., 2020, 48(0): 63-71. |
[7] | Chenfan Yu, Peng Zhang, Zhefeng Zhang, Wei Liu. Microstructure and fatigue behavior of laser-powder bed fusion austenitic stainless steel [J]. J. Mater. Sci. Technol., 2020, 46(0): 191-200. |
[8] | Huihong Liu, Yo Aoki, Yasuhiro Aoki, Kohsaku Ushioda, Hidetoshi Fujii. Principle for obtaining high joint quality in dissimilar friction welding of Ti-6Al-4V alloy and SUS316L stainless steel [J]. J. Mater. Sci. Technol., 2020, 46(0): 211-224. |
[9] | Hongwang Zhang, Yiming Zhao, Yuhui Wang, Chunling Zhang, Yan Peng. On the microstructural evolution pattern toward nano-scale of an AISI 304 stainless steel during high strain rate surface deformation [J]. J. Mater. Sci. Technol., 2020, 44(0): 148-159. |
[10] | Na Wei, Yuan Lin, Zhenkui Li, Wenxia Sun, Guosong Zhang, Mingliang Wang, Hongzhi Cui. One-dimensional Ag2S/ZnS/ZnO nanorod array films for photocathodic protection for 304 stainless steel [J]. J. Mater. Sci. Technol., 2020, 42(0): 156-162. |
[11] | Sharafadeen Kunle Kolawole, Wang Hai, Shuyuan Zhang, Ziqing Sun, Muhammad Ali Siddiqui, Ihsan Ullah, Wei Song, Frank Witte, Ke Yang. Preliminary study of microstructure, mechanical properties and corrosion resistance of antibacterial Ti-15Zr-xCu alloy for dental application [J]. J. Mater. Sci. Technol., 2020, 50(0): 31-43. |
[12] | Shucai Zhang, Huabing Li, Zhouhua Jiang, Zhixing Li, Jingxi Wu, Binbin Zhang, Fei Duan, Hao Feng, Hongchun Zhu. Influence of N on precipitation behavior, associated corrosion and mechanical properties of super austenitic stainless steel S32654 [J]. J. Mater. Sci. Technol., 2020, 42(0): 143-155. |
[13] | C. Garcia-Cabezon, C. Garcia-Hernandez, M.L. Rodriguez-Mendez, F. Martin-Pedrosa. A new strategy for corrosion protection of porous stainless steel using polypyrrole films [J]. J. Mater. Sci. Technol., 2020, 37(0): 85-95. |
[14] | S.G. Wang, M. Sun, S.Y. Liu, X. Liu, Y.H. Xu, C.B. Gong, K. Long, Z.D. Zhang. Synchronous optimization of strengths, ductility and corrosion resistances of bulk nanocrystalline 304 stainless steel [J]. J. Mater. Sci. Technol., 2020, 37(0): 161-172. |
[15] | Wei Cui, Qibin Song, Huhu Su, Zhiqing Yang, Rui Yang, Na Li, Xing Zhang. Synergistic effects of Mg-substitution and particle size of chicken eggshells on hydrothermal synthesis of biphasic calcium phosphate nanocrystals [J]. J. Mater. Sci. Technol., 2020, 36(0): 27-36. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||